EoE

Syndicate content
Updated: 40 weeks 5 days ago

Microbial life in undersea volcanoes

August 15, 2012 - 3:44pm

Many of the lifeforms inhabiting the Earth live in sediments and rocks. The research reported here provides the first detailed data on methane-exhaling microbes that live deep in the cracks of hot undersea volcanoes.

Scientists Define New Limits of
Microbial Life in Undersea Volcanoes

A third of Earth's organisms live in rocks and sediments, but their lives have been a mystery

By some estimates, a third of Earth's organisms live in our planet's rocks and sediments, yet their lives are almost a complete mystery. This week, the work of microbiologist James Holden of the University of Massachusetts-Amherst and colleagues shines a light into this dark world. In the journal Proceedings of the National Academy of Sciences (PNAS), they report the first detailed data on methane-exhaling microbes that live deep in the cracks of hot undersea volcanoes.

"Evidence has built that there's an incredible amount of biomass in the Earth's subsurface, in the crust and marine sediments, perhaps as much as all the plants and animals on the surface," says Holden. "We're interested in the microbes in the deep rock, and the best place to study them is at hydrothermal vents at undersea volcanoes. Warm water there brings the nutrient and energy sources these microbes need."

Just as biologists studied the habitats and life requirements of giraffes and penguins when they were new to science, Holden says, "for the first time we're studying these subsurface microorganisms, defining their habitat requirements and determining how they differ among species."

The result will advance scientists' comprehension of biogeochemical cycles in the deep ocean, he and co-authors believe.

"Studies such as this add greatly to our understanding of microbial processes in the still poorly-known deep biosphere," says David Garrison, program director in the National Science Foundation's Division of Ocean Sciences, which funded the research.

The project also addresses such questions as what metabolic processes may have looked like on Earth three billion years ago, and what alien microbial life might look like on other planets. Because the study involves methanogens--microbes that inhale hydrogen and carbon dioxide to produce methane as waste--it may also shed light on natural gas formation on Earth. One major goal was to test results of predictive computer models and to establish the first environmental hydrogen threshold for hyperthermophilic (super-heat-loving), methanogenic (methane-producing) microbes in hydrothermal vent fluids.

"Models have predicted the 'habitability' of the rocky environments we're most interested in, but we wanted to ground-truth these models and refine them," Holden says.

In a two-liter bioreactor at UMass Amherst where the scientists could control hydrogen levels, they grew pure cultures of hyperthermophilic methanogens from their study site alongside a commercially available hyperthermophilic methanogen species. The researchers found that growth measurements for the organisms were about the same. All grew at the same rate when given equal amounts of hydrogen and had the same minimum growth requirements. Holden and Helene Ver Eecke at UMass Amherst used culturing techniques to look for organisms in nature and then study their growth in the lab.

Co-investigators Julie Huber at the Marine Biological Laboratory on Cape Cod provided molecular analyses of the microbes, while David Butterfield and Marvin Lilley at the University of Washington contributed geochemical fluid analyses.

Using the research submarine Alvin, they collected samples of hydrothermal fluids flowing from black smokers up to 350 degrees C (662 degrees F), and from ocean floor cracks with lower temperatures. Samples were taken from Axial Volcano and the Endeavour Segment, both long-term observatory sites along an undersea mountain range about 200 miles off the coast of Washington and Oregon and more than a mile below the ocean's surface.

"We used specialized sampling instruments to measure both the chemical and microbial composition of hydrothermal fluids," says Butterfield. "This was an effort to understand the biological and chemical factors that determine microbial community structure and growth rates."

A happy twist awaited the researchers as they pieced together a picture of how the methanogens live and work. At the low-hydrogen Endeavour site, they found that a few hyperthermophilic methanogens eke out a living by feeding on the hydrogen waste produced by other hyperthermophiles.

"This was extremely exciting," says Holden. "We've described a methanogen ecosystem that includes a symbiotic relationship between microbes."

The research was also supported by the NASA Astrobiology Institute and the National Oceanic and Atmospheric Administration.

-NSF-
August 6, 2012

Media Contacts

 

Ocean Biogeographic Information System USA

August 15, 2012 - 3:44pm
Ocean Biogeographic Information System USA Lead Image: A map of the world’s ocean showing target areas for biogeography of chemosynthetic ecosystems research. Area "A" (in pink) includes the Equatorial Atlantic Belt region, extending from the seeps off Costa Rica, through the Gulf of Mexico and Caribbean, and across the Atlantic to western Africa. Image courtesy of the ChEss Programme.

The Ocean Biogeographic Information System USA (OBIS-USA), a program of the United States Geological Survey (USGS) Core Science Analytics and Synthesis (CSAS), is the US national node of the Ocean Biogeographic Information System (OBIS). Meant to serve research and natural resource management needs, OBIS-USA brings together marine biological occurrence data in a standard format, with metadata, web-based discovery and download, and web service access for users and applications.

Data sources are US government (including Federal, State and local) agencies, academic, and non-governmental organizations. The data represent species name, location and date, plus additional detail as available. OBIS-USA partners with several federal agencies to play a role in the full life cycle of marine data, from origination, through discovery, dissemination and applications, to archiving at National Ocean Data Center.

OBIS-USA goes beyond the limits traditionally encountered in biodiversity data. It configures the data and web services to enable integration with other data types, such as physical oceanography, water chemistry, climate, and other types. It can integrate application-critical details such as absence, abundance, effort, method, and tracking. Over time, OBIS-USA aims to further identify and innovate yet more categories of important biological observations and details.

For a more in-depth description of OBIS-USA see the OBIS-USA FGDC metadata record.

Partners and Affliates

 

Curiosity Rover

August 14, 2012 - 3:39pm

The Curiosity Rover is designed to examine Martian rocks and soils. Two instruments on its arm can study rocks up close, a drill can collect sample material and a scoop can pick up samples of soil.

NASA's Curiosity Mars Mission
Connects Past and Future This is one of the first images taken by NASA's Curiosity rover, which landed on Mars the evening of Aug. 5 PDT (morning of Aug. 6 EDT). Source: NASA.


NASA's newest Mars mission, that landed on 05 August 2012, will draw on support from missions sent to Mars years ago and will contribute to missions envisioned for future decades.

"Curiosity is a bold step forward in learning about our neighboring planet, but this mission does not stand alone. It is part of a sustained, coordinated program of Mars exploration," said Doug McCuistion, director of the Mars Exploration Program at NASA Headquarters in Washington. "This mission transitions the program's science emphasis from the planet's water history to its potential for past or present life."

As the Mars Science Laboratory spacecraft places the Curiosity rover on the surface of Mars, NASA used the Mars Odyssey orbiter, in service since 2001, as a relay for rapidly confirming the landing to Curiosity's flight team and the rest of the world. Earth was below the Mars horizon from Curiosity's perspective, so the new rover was not in direct radio contact with Earth. Two newer orbiters recorded Curiosity's transmissions, but that data was not available on Earth until hours later.

When Curiosity landed beside a mountain inside a crater at about 10:32 p.m. PDT, Aug. 5 (1:32 a.m. EDT Aug. 6), the 1-ton rover's two-year prime mission on the surface of Mars began. However, one of the rover's 10 science instruments, the Radiation Assessment Detector, or RAD, already has logged 221 days collecting data since the spacecraft was launched on its trip to Mars on Nov. 26, 2011.

"Our observations already are being used in planning for human missions," said Don Hassler of Southwest Research Institute in Boulder, Colo., principal investigator for Curiosity's RAD.

The instrument recorded radiation spikes from five solar flare events spewing energetic particles from the sun into interplanetary space. Radiation from galactic cosmic rays, originating from supernova explosions and other extremely distant events, accounted for more of the total radiation experienced on the trip than the amount from solar particle events. Inside the spacecraft, despite shielding roughly equivalent to what surrounds astronauts on the International Space Station, RAD recorded radiation amounting to a significant contribution to a NASA astronaut's career-limit radiation dose.

Curiosity's main assignment is to investigate whether its study area ever has offered environmental conditions favorable for microbial life. To do that, it packs a science payload weighing 15 times as much as the science instruments on previous Mars rovers. The landing target, an area about 12 miles by 4 miles (20 kilometers by 7 kilometers), sits in a safely flat area between less-safe slopes of the rim of Gale Crater and the crater's central peak, informally called Mount Sharp. The target was plotted to be within driving distance of layers on Mount Sharp, where minerals that formed in water have been seen from orbit.

"Some deposits right inside the landing area look as though they were deposited by water, too," said John Grotzinger of the California Institute of Technology (Caltech) in Pasadena, project scientist for Curiosity. "We have a great landing site that was a strong science contender for earlier missions, but was not permitted for engineering constraints because no earlier landing could be targeted precisely enough to hit a safe area inside Gale Crater. The science team feels very optimistic about exploration of Mount Sharp and the surrounding region that includes the landing ellipse."

Mission engineers designed a sky crane maneuver, lowering Curiosity on nylon cords from a rocket backpack because the rover is too heavy to use the airbag system developed for earlier rovers. "We know it looks crazy," said Adam Steltzner of NASA's Jet Propulsion Laboratory (JPL) in Pasadena, leader of the team that developed the system. "It really is the result of careful choices." By designing the aeroshell enclosing Curiosity to create lift and be steerable, engineers were able to build a system that lands much more precisely instead of dropping like a rock.

JPL, a division of Caltech, manages the Mars Science Laboratory for NASA's Science Mission Directorate, Washington.

For more information about the mission is available at http://www.nasa.gov/mars and http://mars.jpl.nasa.gov/msl/ .

NASA Contacts
  • Guy Webster/D.C. Agle 818-354-6278/818-393-9011
    Jet Propulsion Laboratory, Pasadena, Calif.
    Guy.Webster@jpl.nasa.gov / Agle@jpl.nasa.gov
  • Dwayne Brown/Steve Cole
    NASA Headquarters, Washington 202-358-1726/202-358-0918
    dwayne.c.brown@nasa.gov / stephen.e.cole@nasa.gov

2012-224
08.02.12

Improving access to and use of earth science data

August 10, 2012 - 2:35pm
USGS Helps Debut New Technology to
Improve Access and Use of Earth Science Data

Researchers investigating global issues now have an easy method for finding and using earth science data through a new technology developed by the Data Observation Network for Earth, or DataONE.  

Understanding broad and complex environmental issues, for example climate change, increasingly relies on the discovery and analysis of massive datasets. But the amount of collected data—from historical field notes to real-time satellite data—means that researchers are now faced with an onslaught of options to locate and integrate information relevant to the issue at hand. 

DataONE, a ten-institution team with several hundred Investigators, including researchers from the United States Geological Survey (USGS), is addressing this data dilemma with a number of cyberinfrastructure and educational tools to allow long-term access and usage of earth science data and information. The recently released ONESearch tool queries data centers located around the world for relevant earth science information and provides integrated access to science metadata and corresponding datasets. 

Through DataONE, researchers from all over the world will be able to share their research and benefit from the total body of earth science. This level of collaboration is a necessity for accurate and robust science in wide-ranging, complex topics like climate change, sea-level rise, and invasive species. 

For instance, to accurately model the likely effects from climate change, data from all corners of the globe have to be collected and analyzed. As a result, these datasets are enormous, and wading through them to find the most important pieces of information can be time-consuming and laborious.

DataONE simplifies this process by providing several tools, the underlying cyberinfrastructure, standards, and educational materials that streamline access to a multitude of earth science and environmental data. Now, through a single point, scientists have access to globally distributed, networked Earth observational data, best practices to share their data, and, most importantly, tools to use that they are already familiar with in managing and analyzing their data/research results. 

"One common challenge in the environmental sciences is the need to find and merge multiple data streams in order to solve real-world problems," said USGS Director Marcia McNutt. "The availability of DataONE tools will accelerate progress on some of the most important issues facing society by providing standard solutions to these common, time-consuming hurdles." 

DataONE's search tool, ONESearch, enables researchers to easily integrate previously incompatible datasets. For example, one DataONE working group has combined a database of amateur bird sightings with environment data layers about land use, protected areas, weather, and vegetation to make refined predictions about bird migration patterns. This activity, along with additional USGS data from the Gap Analysis Program, helped to produce the DOI State of the Birds report. 

"DataONE is a powerful tool for collaborative research," said Mike Frame, Principal Investigator and USGS lead for involvement with DataONE. "Through it, scientists, land managers, policy makers, students, educators, and the public can benefit from research conducted around the world without having to pull all of the data together from a multitude of sources." 

DataONE was made possible by a $20 million award through the National Science Foundation's DataNet program. The USGS is the primary Federal agency participating in this grant. Other partners in the DataONE collaboration include the other DOI Bureaus and other Federal agencies, including NASA and the U.S. Environmental Protection Agency. 

About CSAS

USGS' primary involvement with DataONE comes through the USGS Core Science Systems Core Science Analytics and Synthesis Program (CSAS). With expertise in technology, information, and science, CSAS leads the management and delivery of scientific data and information for the USGS. USGS CSAS is also identifying and providing improved access to other critical data holdings from DOI Bureaus and other Federal Agencies, including NASA and the Environmental Protection Agency.  

CSAS implements and promotes standards and best practices to enable efficient, data-driven science for decision making that supports a rapid response to emerging natural resource issues. CSAS has established the USGS DataONE Member Node to make USGS data more visible and discoverable within the DataONE network. Additionally, through CSAS participation in DataONE, USGS scientists will more easily access other Federal and non-Federal organizations’ earth science data in support of their research endeavors. Finally, through CSAS contributions to best practices, educational modules, and community assessments, DataONE and USGS are providing scientists with sound, sustainable, and easy-to-use methods to ensure long-term availability of their data. 

Learn More:

Released: 7/25/2012 12:00:00 PM

Contact Information:
U.S. Department of the Interior, U.S. Geological Survey
Office of Communications and Publishing
12201 Sunrise Valley Dr, MS 119
Reston, VA 20192 Mike Frame
Phone: 865-576-3605

Vivian Hutchison
Phone: 303-202-4227

Lisa Zolly
Phone: 703-648-4277
 


 

 
  •  

 

U.S. Survey of State Government R&D Expenditures

August 9, 2012 - 2:28pm
NSF Report Detailing Nationwide and State-by-State
R&D Activities Performed by State Government Agencies


Agencies in the top five states accounted for 47 percent of all state agency R&D expenditures

The FY 2009 survey is the most recent NSF survey of R&D activities performed and funded by state government agencies in each of the 50 states and the District of Columbia. For the first time, NSF is publishing survey data by individual state agency. Credit: NSF

 

A report (FY 2009 Survey of State Government R&D Expenditures) released by the National Science Foundation (NSF) found state agency expenditures for research and development totaled $1.2 billion in fiscal year 2009, a 7 percent increase over the fiscal 2007 total of $1.1 billion.

The InfoBrief details nationwide and state-by-state totals of R&D activities performed and funded by state government agencies. This is the first time survey data are available by individual state agencies. Previously only state totals were published.

This survey also marked the first time NSF asked state agencies to classify their R&D according to the following five categories:

  • Agriculture: animal health; aquaculture; crop management; food and commodities; forestry
  • Environment and Natural Resources: air and water quality; fish, game, and wildlife; marine and aquatic environments; geological survey; parks and preserves; soil and water conservation
  • Health: biomedical research; mental health and addiction; public health
  • Transportation: highways, roads, and bridges; ports and waterways; public transportation; rail and freight; aviation
  • Other: R&D in other areas, such as corrections, education, energy, labor, public safety, and social services

In addition to the $1.2 billion on R&D, state agencies also expended $103 million on R&D facilities, for a total of $1.3 billion in fiscal 2009.

The level of R&D expenditures reported by state agencies ranged from $0.5 million in the District of Columbia to $147 million in California.

The fiscal 2009 survey is the most recent NSF survey of R&D activities performed and funded by state government agencies in each of the 50 states and the District of Columbia.

For more information on this report, please contact Michael Yamaner.

Please visit the NSF's National Center for Science and Engineering Statistics (NCSES) for more reports and other products.

-NSF-
August 2, 2012

Media Contact

Program Contact

Melanoma in wild marine fish

August 8, 2012 - 2:10pm

Increasingly, the prevalence and occurrence of novel diseases are being observed and reported in a wide spectrum of organisms worldwide. Understanding the origins of these diseases, the host organisms that are affected and the potential causes and consequences are a vital first step in the development of control and management strategies.

This research article, written by Michael Sweet, Nigel Kirkham, Mark Bendall, Leanne Currey, John Bythell, and Michelle Heupel*, appeared first in PLOS ONE—an international, peer-reviewed, open-access, online publication.

The article is a verbatim version of the original and is not available for edits or additions by Encyclopedia of Earth editors or authors. Companion articles on the same topic that are editable may exist within the Encyclopedia of Earth.

Evidence of Melanoma in Wild Marine Fish Populations Abstract

The increase in reports of novel diseases in a wide range of ecosystems, both terrestrial and marine, has been linked to many factors including exposure to novel pathogens and changes in the global climate. Prevalence of skin cancer in particular has been found to be increasing in humans, but has not been reported in wild fish before. Here we report extensive melanosis and melanoma (skin cancer) in wild populations of an iconic, commercially-important marine fish, the coral trout Plectropomus leopardus. The syndrome reported here has strong similarities to previous studies associated with UV induced melanomas in the well-established laboratory fish model Xiphophorus. Relatively high prevalence rates of this syndrome (15%) were recorded at two offshore sites in the Great Barrier Reef Marine Park (GBRMP). In the absence of microbial pathogens and given the strong similarities to the UV-induced melanomas, we conclude that the likely cause was environmental exposure to UV radiation. Further studies are needed to establish the large scale distribution of the syndrome and confirm that the lesions reported here are the same as the melanoma in Xiphophorus, by assessing mutation of the EGFR gene, Xmrk. Furthermore, research on the potential links of this syndrome to increases in UV radiation from stratospheric ozone depletion needs to be completed.
 

Introduction

Prevalence and occurrence of novel diseases are reported to be increasing in many organisms worldwide. Understanding the etiology of these diseases, the host organisms they affect and potential causes and consequences are a vital first step in the development of control and management strategies. Many diseases are caused by microbial pathogens, and fish diseases in particular have been shown to be caused by a diversity of such pathogens including bacteria, parasitic copepods, viruses and fungi [1], [2], [3]. Historically, diseases in fish have been recorded more commonly in species of commercial value, usually farmed fish. This may be due to the higher than normal stocking densities which in turn can lead to higher levels of infections and/or the ease of sampling large numbers and continuous monitoring capabilities. Furthermore, there is also significant economic benefit to identifying pathogens of these commercially reared fish with the aim of ultimately curing them. In aquaculture systems, diseases cause a significant economic loss, with bacteria, viruses and fungi being the dominant pathogens involved [1], [3]. In contrast, diseases of wild fish have received considerably less attention and their economic impact on commercial and recreational fisheries is unknown. In addition to microbial diseases common in fish, other diseases such as carcinomas have been extensively studied in the laboratory using fish model systems, including the Xiphophorus (swordtail) [4], [5] and, more recently, the Danio (zebrafish) models [5], [6]. To date, however, there are no reports of cancers occurring in wild fish populations. This study aimed to describe a previously unknown disease lesion, which was observed affecting large numbers of a commercially important reef fish, the coral trout Plectropomus leopardus.

Methods Sampling

Individual coral trout, Plectropomus leopardus, were line caught with barbless 8/0 hooks using pilchard bait, following methods employed by commercial fishers. Four fishing trips were completed between Aug 2010 and Feb 2012 off the east coast of Australia, at Heron Island (23.4°S, 151.9°E) and One Tree Island (23.5°S, 152.0°E). In total 136 fish were sampled and photographed, 20 of which showed signs of skin abnormalities. From healthy individuals and those with the syndrome, two sets of samples were taken; one for microbial analysis and the other for histological examination. Additional affected individuals were observed during snorkel and dive activities, but only those individuals captured via fishing were included in this analysis.

To test for differences in bacterial, fungal and ciliate molecular diversity between healthy and lesion samples, we analyzed tissue sections collected from individuals captured in August 2011. Three replicate tissue sections (~10l×3 w×3 d cm), separated by ~5 cm were cut using a sterile scalpel blade from n = 5 non-diseased (ND) fish, n = 5 diseased (D) fish (Fig. 1a) at the lesion interface and n = 5 apparently healthy (AH) tissues adjacent to the lesion on a disease fish. Samples were placed directly into 100% EtOH and stored at −20°C until extraction and further analysis. A further set of samples, aimed at sampling the surface associated microbes, utilised sterile swabs. The surface of the fish scales were swabbed and these were placed directly into sterile micro-centrifuge tubes with 100% EtOH, stored at −20°C until extraction and further analysis. Further samples, aimed at sampling the surface associated microbes used sterile swabs. These were placed in sterile micro-centrifuge tubes and stored in 100% EtOH at −20°C until extraction. Samples for histology were collected as for microbial analysis (see above), with the same sample number of samples however, they were preserved in 5% paraformaldehyde made up with Phosphate Buffer Saline (PBS). Samples were fixed for 24 hr, dehydrated in a dilution series of EtOH from 50 to 100% and stored at 4°C until embedding and sectioning. DNA was extracted using the QIAGEN DNeasy Blood and tissue extraction kit.

Figure 1. Lesions were present on approximately 15% of the sampled population of Plectropomus leopardus; a) affected individual showing <10% coverage of body surface; b) P. leopardus with almost complete coverage >90%; c) healthy tissue under light microscope and d) the lesion.

Scale bars = 20 µm.

doi:10.1371/journal.pone.0041989.g001 Fungal PCR amplification and denaturing gradient gel electrophoresis (DGGE) of tissue samples/swabs

For DGGE analysis a portion of the fungal ITS rRNA gene was amplified using universal fungal primers; a nested PCR approach was utilised to yield the most complete diversity [7]. 1st round; fungal primers ITS1F (5′CTTGGTCATTTAGAGGAAGTAA-3′) and ITS4 (5′-TCCTCCGCTTATTGATATGC-3′) [8] were used following the protocol described by [9] (94°C for 5 min; 35 cycles at; 94°C for 30 sec, 55°C for 30 sec, 72°C for 30 sec then elongation at 72°C for 5 min). 20 µl PCR reactions were routinely used (final PCR buffer contained: 1 mM MgCl2, and 1 U Taq DNA polymerase (QBiogene); 100 µM dNTPs; 0.2 µM of each of the forward and reverse primers; and 0.4% BSA, with 20 ng of template DNA). A 1:100 dilution of the PCR product was then used in a further PCR with the primers ITS3 (5′-GCATCGATGAAGAACGCAGC-3′) and ITS4-GC (5′-CGCCCGCCGCGCCCCGCGCCCGGCCCGC CGCCCCCGCCCC-TCCTCCGCTTATTGATATGC -3′) [10]. All reactions were performed using a Hybaid PCR Express thermal cycler. PCR products were verified by agarose gel electrophoresis [1.6% (w/v) agarose] with ethidium bromide staining and visualized using a UV transilluminator. DGGE was performed using the D-Code universal mutation detection system (Bio-Rad). PCR products were resolved on 10% (w/v) polyacrylamide gels that contained a 30–60% formamide (denaturant) gradient for 13 h at 60°C and a constant voltage of 50 V. Gels were stained with SYBER gold as described by [11]. Bands of interest (those which explained the greatest differences/similarities between samples) were excised from DGGE gels, left overnight in Sigma molecular grade water, vacuum centrifuged, re-amplified with the specific primers, labelled using Big Dye (Applied biosystems) transformation sequence kit and sent to Genevision (Newcastle University, UK) for sequencing. Fungal operational taxonomic units (OTUs) were defined from DGGE band-matching analysis using BioNumerics 3.5 (Applied Maths BVBA).

Bacterial PCR amplification and denaturing gradient gel electrophoresis (DGGE) of tissue samples/swabs

Extraction was the same as above. For DGGE analysis a portion of the bacterial 16S rRNA gene was amplified using universal eubacterial primers [12]; (357F-GC) (5′-CCTACGGGAGGCAGCAG-3′) and (518R) (5′- CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCAGCACGGG​GGG-ATTACCGCGGCTGCTGG-3′). PCR reaction mixtures and program were as described by [11]. PCR products were resolved on 10% (w/v) polyacrylamide gels that contained a 30–60% formamide (denaturant) gradient for 13 h at 60°C and a constant voltage of 50 V. Gels were stained as above and bands of interest were excised from DGGE gels, labelled and sent to Genevision (Newcastle University, UK) for sequencing. Bacterial OTUs were defined from DGGE band-matching analysis using Bionumerics 3.5 (Applied Maths BVBA).

Ciliate PCR amplification and denaturing gradient gel electrophoresis (DGGE) of tissue samples/swabs

Ciliates 18S rRNA genes were amplified with an un-nested PCR approach. PCR mixture was as above with the forward primer CilF (5′-TGGTAGTGTATTGGACWACCA-3′) with a 36-bp GC clamp [13] attached to the 5′ end and CilDGGE-r (5′TGAAAACATCCTTGGCAACTG-3′). Initial denaturation was at 94°C for 5 min, followed by 26 cycles of 94°C for 1 min, 52°C for 1 min, and 72°C for 1 min and a final elongation step of 10 min at 72°C to reduce double bands in the DGGE patterns. The DGGE was carried out using a D-code system (Bio-Rad) with 0.75 mm thick 6% polyacrylamide gels in 1× TAE buffer. Electrophoresis was carried out for 16 h at 60°C and 50 V in a linear 32 to 42% denaturant (formamide) gradient. Gels were stained as above.

Statistic analysis of microbial communities

In order to assess variation in microbial assemblages (bacterial, fungal and ciliate), matrices consisting of OTU's and samples were generated using both presence/absence and band intensity data, using marker lanes for between-gel comparisons. Changes in microbial assemblages were evaluated with a one-way analysis of similarity (Primer, ANOSIM) and multi dimensional scaling (MDS), based on Bray-Curtis similarities, which was performed on all samples sets, healthy, apparently healthy and diseased.

Histology

Samples were collected as for microbial analysis; however tissue samples were preserved with 5% paraformaldehyde for 24 hrs then stored in 100% EtOH until resin embedding in LR white (r). For each tissue type, the location of bacteria was recorded using fluorescent in situ hybridisation (FISH) and the general fluorescent stain, 4′6-diamidino-2-phenylindole (DAPI). For FISH, samples were stained and sectioned following the protocols in [14], with the addition of an equimolar mix (EUBMIX). Oligonucleotide probes were purchased from Interactiva (http://www.interactiva.de) with an aminolink C6/MMT at the 5′ end. Four probes were used: the ‘universal’ eubacterial probes EUB338 (5′-GCT GCC TCC CGT AGG AGT-3′), EUB338-II (5′-GCA GCC ACC CGT AGG TGT-3′), EUB338-III (5′-GCT GCC ACC CGT AGG TGT-3′) and the ‘non-sense probe’ NONEUB (5′-ACT CCT ACG GGA GGC AGC-3′), which has the complementary sequence to EUB338, used to determine non-specific binding of EUB338. The three eubacterial probes were used in an equimolar mix (EUBMIX) and the NONEUB probe was used singly. DAPI staining followed the protocol by [11], whereby each section was stained with 100 µl of 4% PBS buffered paraformaldehyde solution containing 4′6-diamidino-2-phenylindole (final concentration 5 µg ml−1) for 10 minutes, rinsed with filtered 1× PBS pH 7.4. All sections were viewed under epiflourescence microscopy with an FITC-specific filter block (Nikon UK Ltd, Surrey, UK) and images recorded using an integrating camera (Model JVC KY-SSSB: Foster Findlay and Associates, Newcastle upon Tyne, UK). Samples of pure cultured E.coli were run alongside each section and for each staining protocol as a positive stain.

Further histological samples were stained with the melanin specific stain, Fontana-Mason, melanin granules reduce silver nitrate to metallic silver, which results in a histochemical reaction that participates black material wherever melanin is located [15].

Samples for Scanning Electron Microscopy (SEM) were dehydrated using EtOH and PBS; 25% EtOH, 50% EtOH, 75% EtOH (30 mins each), then a further (2×1 hr) in 100% EtOH, with final dehydration using carbon dioxide in a Baltec Critical Point Dryer. Specimens were then mounted on an aluminium stub with Achesons Silver Dag (dried overnight) and coated with gold (standard 15 nm) using a Polaron SEM Coating Unit. Specimens were examined using a Stereoscan 240 Scanning Electron Microscope, and digital images collected by Orion6.60.6 software.

Samples for Transmission Electron Microscopy (TEM) were dehydrated using 25% acetone, 50% acetone, 75% acetone, (30 min each) and 100% acetone (2×1 h). Then impregnated with 25% LR White resin in acetone, 50% resin/acetone, 75% resin/acetone (1 h each), then 100% resin for minimum of 3 changes over 24 h, with final embedding in 100% resin at 60°C for 24 hrs. Survey sections of 1 µ were cut and stained with 1% Toluidine Blue in 1% Borax. Ultrathin sections (80 nm approx) were then cut using a diamond knife on a RMC MT-XL ultramicrotome. These were then stretched with chloroform to eliminate compression and mounted on Pioloform filmed copper grids. Staining was with 2% aqueous Uranyl Acetate and Lead Citrate (Leica). The grids were then examined using a Philips CM 100 Compustage (FEI) Transmission Electron Microscope and digital images were collected using an AMT CCD camera (Deben) at the Electron Microscopy Research Services Laboratory, Newcastle University.

Results and Discussion

Approximately 15% of samples from a population of Plectropomus leopardus line caught at two locations in the southern Great Barrier Reef Marine Park - Heron Island and One Tree Island - showed evidence of a dark growth lesion (Fig. 1a,b), similar in appearance to those reported from laboratory induced melanomas seen in the fish Xiphophorus [16]. Prevalence of skin lesions was not significantly different (Chi Square = 0.063, df = 1, p = 0.803) between reef platforms with 14.1% of individuals at Heron Island and 15.7% of individuals at One Tree Island affected. In this study, the fish displaying these skin lesions struck fishing hooks as strongly as healthy individuals, appeared to have good muscle tone and were assessed by external examination as healthy aside from the skin discolouration. Coverage of the lesion on individual fish varied from <10% of body surface (Fig. 1a) to almost complete coverage (Fig. 1b). Although the size range of individuals sampled was limited (344–639 mm fork length), there was no relationship between percent cover and fish size (r2 = 0.02). Small individuals (468 mm) could show up to 98% lesion cover and larger individuals (639 mm) showed as little as 30% cover, indicating that prevalence can occur at varying sizes and ages. Lesions affected the surface of the fish caught, with a change from the characteristic blue-spotted patterning (Fig. 1c) in healthy individuals to raised lesions which were darker black/brown in coloration (Fig. 1d). Location of the lesions on the body varied between individuals.

Associated microbial (rRNA gene) communities

Analysis of microbial communities associated with healthy (non-diseased) and diseased fish, which would highlight potential pathogenic agents (those present in lesions and absent in healthy samples [17], [18]), was conducted using culture-independent (rRNA gene) molecular screening techniques. Swabs of the mucus and tissue samples from healthy fish, apparently healthy tissues on affected fish, and the lesion itself were sampled. Microbial (rRNA gene) diversity assessed using bacterial-, fungal- and ciliate-specific PCR primers showed no significant difference (p>0.45) between the sample types. No known microbial pathogen sequences were found in lesion samples that were absent or in lower numbers within healthy and/or apparently healthy samples (Fig. 2a). The technique utilised in this study has routinely been used successfully in other studies to highlight potential microbial pathogens [19], [20], [21]. Furthermore, no significant differences (p = 0.12) was found between tissue sections and non-invasive surface mucus swabs, suggesting that the microbial communities detected were mainly present on the surface of the fish and not in the dermis or muscle tissues, where the lesion recorded. Histological sections visualised with either Fluorescence In Situ Hybridisation (FISH) using eubacterial probes [14] or the general nucleic acid stain DAPI (Fig. 2b,c), showed no microbial populations within the dermis, which supports the conclusion that the microbes detected using culture-independent screening were associated with the surface mucus layer of the fish. No evidence of these or other microbes such as virus like particles (VLPs) were detected using either Scanning Electron Microscopy (SEM) for surface microbes (Fig. 3a,b), or Transmission Electron Microscopy (TEM) (Fig. 4e, f, g, h) for those within the tissues. Processing for SEM and TEM would have removed the surface mucus layer; again supporting the conclusion that few, if any, microbes were present within the dermis at the sites of pathogenesis.

Figure 2. Microbial analysis of Plectropomus leopardus samples; a) Bacterial 16S rRNA gene fingerprints (represented on Denaturing Gradient Gel Electrophoresis) of fish mucus (SWB) and tissue samples (TSU), standardised for gel-to-gel comparison using BioNumerics; b) resin embed histological section of a healthy fish, stained with the general DNA stain 4′6-diamidino-2-phenylindole (DAPI); c) histological section of the lesion on a diseased fish stained with DAPI, both showing no bacteria within the dermis suggesting the bacteria present in (a) are localised within the mucus layer not within the tissues.

Scale bars = 10 µm.

doi:10.1371/journal.pone.0041989.g002

 

 

 

Figure 3. Microscopic images of Plectropomus leopardus tissues; a) Scanning Electron Micrograph (SEM) of the healthy tissue; b) SEM of the lesion.

MGC = mucus goblet cells, M = mucus. c) Light microscope image of a healthy scale and d) light microscope image of a diseased scale, showing disorganisation of natural melanin patterns seen in (c). Scales bars = 10 µm.

doi:10.1371/journal.pone.0041989.g003

 

 

 

 

 

 

Figure 4. Histological section of LR white resin embedded samples of healthy and diseased Plectropomus leopardus; a) Healthy section stained with toluidine blue; b) lesion stained with toluidine blue; c) healthy section stained with melanin specific stain Masson-Fontana; d) lesion stained with Masson-Fontana; e) Transmission Electron Micorgraph (TEM) of healthy section; f) TEM of lesion; g) higher magnification of TEM in (e); h) higher magnification of TEM in (f).

Scale bars for (a–f) = 10 µm; scale bars for (g) and (h) = 2 µm. D = dermis (cologne of stroma), E = epithelium, M = melanosome, N = cell nucleus, CBM = caliginous basal membrane. Double headed arrows shows thickening of the integument, characteristic of laboratory induced-melanomas in the Xiphophorus model.

doi:10.1371/journal.pone.0041989.g004

 

Histopathological analyses

Melanin-containing cells (melanosomes) were found to be in higher density, more widespread and with a deeper distribution within the lesions than compared to healthy tissue sections (Fig. 1c, d and Fig. 3c, d). In normal fish skin these cells are restricted to the immediate subepithelial dermis and are responsible for the pigment patterns in the integument [22]. Melanosomes are normally found to be well organised and clustered in tight groups throughout the dermis beneath the epidermal basement membrane (Fig. 4a, c, e, g). Sections from apparently healthy areas of skin from affected fish showed this normal pattern, whilst samples from lesional plaques, which often occurred in areas that are not normally pigmented, showed a tumourous appearance of disorganised pleomorphic cells containing melanosomes (Fig. 4b, d, f, h). Melanosomes in the lesions contained more pigment and were thought to be mature, older cells [5]. The number of melanosomes, and hence pigmentation, in the cells varied from completely absent (Cell B) to cells with plentiful melanosomes (Cell A). Melanin-specific Masson-Fontana-stained sections (Fig. 4c, d) were used to visualise these melanin-producing pigmented cells. A thickening of the integument (Fig. 4a,b double headed arrows) and extensive melanosis (development of melanotic overgrowths, which in turn is a consequence of extreme pigment cell proliferation), can clearly be seen in the cases of all lesion samples in this study and are characteristic of laboratory induced-melanomas in the Xiphophorus model [16]. Usually there is little distinction between premalignant melanosis and melanomas, whereby in the former the number of pigmented cells (melanophores) is increased but restricted to the dermis (as was the case for most of the lesions in this study), and in the latter the melanophores invade the underlying tissues. However, 5 prominent types of melanomas have previously been distinguished [16], one of which Melanophorous-Macromelanophorous Polymorphic Melanoma (MMPM) is known to be heterogeneous, with heavily and lightly pigmented areas, as observed here. Lesions contained different cell types, including melanocytes, epitheliod-like cells, melanophores and macromelanophore cells (Fig. 4f,h and Fig. 5b), consistent with MMPM. Interestingly, the majority of P. leopardus examined, exhibited lower density and coverage of skin lesions (Fig. 1a). However, this may be due to the sampling regime utilised in this paper. This was further reflective histopathologically, with stage I or stage II melanomas as described by [23], where the macromelanophores were restricted to the dermis, the meninges, the peritoneum, and the perivascular connective tissue of the blood vessels (Fig. 5b). No fish analysed in this study showed a more advanced stage of melanoma development, stage III, IV and V, where the macromelanophores penetrate the stratum compactum of the dermis and invade the underlying muscles. Fishes exhibiting this more advanced stage may show behavioural differences in the wild and may therefore have not been caught using the techniques utilised in this study. Further work to follow disease progression on captive held individuals would highlight the spread of the lesion, show the different stages of cancer, and show whether this type of melanoma is benign or malignant.

Figure 5. Transmission Electron Micrographs of different samples of P. leopardus exhibiting; (a) healthy tissue showing the two cell types (A & B) associated in the dermis along the collagenous basal membrane (CBM).

Cell A shows localisation of melanosomes and Cell B shows absence of melanosomes in the same area. (b) Lesion showing disorganisation of pleomorphic cells (A & B) with an increase in number and spread of melanosomes. This lesion is an example of a P. leopardus suffering from stage II melanoma, where the melanosomes are restricted to the dermis. Scale bars = 10 µm.

doi:10.1371/journal.pone.0041989.g005

Given the strong histopathological similarities between the lesions described here in P. leopardus and the UV radiation-induced melanomas in the laboratory model Xiphophorus [5], [22], along with a lack of any evidence for a pathogenic cause, we conclude that this represents the first case of melanoma in a wild fish population. As the sampled fish were collected offshore in a marine protected area with no reports of pollution, the likelihood of potential carcinogenic pollutants being the causal factor is low, at least in this reported case. UV radiation, in comparison, is known to be a causal factor in skin damage in many animals and therefore is a likely driving factor of prevalence of melanoma in P. leopardus. There is a significant correlation between average solar radiation (i.e. latitude) and melanoma mortality in humans [5], [24]. UV-B (λ = 280–320 nm) appears to be the most damaging radiation [25] and has previously been shown to increase in intensity as stratospheric ozone levels have decreased [26]. UV radiation in aquatic systems has previously been reported to have detrimental effects on marine and freshwater organisms, with UV penetrating as deep as 60 m in the sea [27], [28], [29]. Therefore P. leopardus inhabiting the clear waters of the Great Barrier Reef would be exposed to UV radiation over a wide depth range. Individuals in this study were all captured in less than 20 m depth, well within the UV-B exposure range of 30 m [27]. Interestingly, juvenile hammerhead sharks have been shown to have the ability to ‘sun tan’ [30], whereby integumental pigments such as melanin increased in direct response to increases in solar radiation. The juvenile shark's skin responded similarly to that observed in humans and other vertebrates in response to direct sunlight, turning from brown to black. Although a similar melanin response was seen in this study (i.e. increased melanin concentration), the sharks in this previous study showed no visible lesions or growths and were therefore not shown to contract melanomas or dermal carcinomas.

With regard to the Xiphophorus induced melanoma model, it had long been assumed that only hybrid crosses of Xiphophorus (those bred in captivity), could be induced to contract melanomas or experience extensive melanosis. The wild (parental) types of these species in comparison, were non-susceptible to neoplasia, even after exposure to high doses of physical and chemical carcinogens [4], [31]. However, in addition to this study illustrating melanosis/melanoma induction in wild type Plectropomus, one further study on Xiphophorus also showed non-hybrid melanoma formation in a wild caught fish, however this was accredited to a build up of androgen metabolites within the holding tank [22]. Hybrid strains of Xiphophorus have been noted to have differing susceptibility to carcinogens suggesting a genetic basis for susceptibility to melanoma formation [32]. Furthermore, it has been shown that melanoma in Xiphophorus is caused by a mutated EGFR gene, Xmrk, with constitutive expression of growth factors. When Xmrk, is transplanted into another fish Oryzias latipes, they subsequently contract melanomas themselves [33], [34]. Therefore, this suggests an underlying genetic predisposition to the disease that is expressed with the loss of tumour suppressor genes caused by the onset of hybridisation. The occurrence of melanoma in a wild population, particularly, at the levels observed in this study is unusual. The relatively high (15%) prevalence of this syndrome within the sampled P. leopardus population may be indicative of a similar genetic defect as that experienced during hybridisation in the laboratory, or alternatively it may be due to potential inbreeding in this portion of the P. leopardus population resulting in recessive susceptibility genes becoming homozygous. In the latter instance, inbreeding may be potentially proliferated in the local area due to recruitment of genetically related individuals to the same reef system [35]. However, hybridisation has frequently been shown to occur in wild populations of many fish species [36], [37], including populations of P. leopardus which have been shown to hybridise with other Plectropomus species, such as the Bar-cheeked coral trout, P. maculatus [38]. Frisch and van Herwerden (2006) concluded that despite behavioural barriers to reproduction (such as assortative mating), there was considerable opportunity for hybridisation between different species of coral trout. Indeed, the same macroscopic signs of this disease have been noticed on P. maculates and one further species, the blue spotted coral trout, P. laevis, suggesting hybridisation between these species may be the most likely cause of predisposition of Plectropomus to melanomas. Current information suggests this syndrome is present throughout the Great Barrier Reef (MRH unpublished data), but prevalence appears to be highest in the southern Great Barrier Reef. This high prevalence recorded in this study further supports the presence of a genetic component to this syndrome, yet detailed, broader sampling is required to confirm the extent of prevalence in other Great Barrier Reef regions.

Coral trout, P. leopardus, is an iconic and highly valued species and the Great Barrier Reef is one of the world's most pristine and carefully managed reef habitats. Successful management of these resources is a crucial and challenging task [39]. The implications of extensive melanosis/melanoma in wild coral trout will depend on the prevalence of the syndrome outside the study region, the causal factors and the proportion which develop into fatal melanomas. However, this syndrome will no doubt have implications for the management of fish populations and the GBR marine park. Beyond health implications for individual fish, this syndrome may have implications for the population as a whole and the commercial and recreational fisheries that exploit this species. In Xiphophorus, fish with tumours usually survive around 6 months, compared to an average of 4 years in healthy fish, but any change in their environment, such as a drop in temperature can rapidly lead to death [5]. It is unclear whether future changes in the ocean environment or climate will similarly exacerbate the effect of melanomas in wild P. leopardus populations, but clearly further research is urgently needed to understand the distribution, prevalence, ecological and fisheries significance of this syndrome. In particular, further studies should focus on UV exposure as a risk factor and confirm whether there is a genetic effect to susceptibility of the syndrome. Utilising molecular markers used to study melanomas in humans and laboratory fish models e.g. those that target the B-Raf protein [40], the EGFR gene, Xmrk, or other mitochondrial DNA status markers [41] would highlight this genetic aspect.

References
  1. Toranzo AE, Magarinos B, Romalde JL (2005) A review of the main bacterial fish diseases in mariculture systems. Aquaculture 246: 37–61. Find this article online
  2. Ebrahimzadeh Mousavi HA, Khosravi AR, Firouzbakhsh F, Mokhayer B, Sasani F, et al. (2005) A case report of Branchiomyces infection in common carp (Cyprinus carpio) from Iran. Iranian Journal of Fisheries Science 5: 105–112. Find this article online
  3. Ramaiah N (2006) A review on fungal diseases of algae, marine fishes, shrimps and corals. Indian Journal of Marine Sciences 35: 380–387. Find this article online
  4. Anders F, Diehl H, Scholl E (1980) Differentiation of normal melanophores and neoplastically transformed melanophores in the skin of fishes of genus Xiphophorus. Linnean Society Symposium Series 211–218. Find this article online
  5. Setlow RB, Woodhead AD, Grist E (1989) Animal model for ultraviolet radiation induced melanoma - Platyfish swordtail hybrid. Proceedings of the National Academy of Sciences of the United States of America 86: 8922–8926. Find this article online
  6. Lewis TJ (2010) Toxicity and Cytopathogenic Properties Toward Human Melanoma Cells of Activated Cancer Therapeutics in Zebra Fish. Integrative Cancer Therapies 9: 84–92. Find this article online
  7. Gao Z, Li B, Zheng C, Wang G (2008) Molecular detection of fungal communities in the Hawaiian marine sponges Suberites zeteki and Mycale armata. Applied and Environmental Microbiology 74: 6091–6101. Find this article online
  8. Vancov T, Keen B (2009) Amplification of soil fungal community DNA using the ITS86F and ITS4 primers. Fems Microbiology Letters 296: 91–96. Find this article online
  9. Anderson IC, Campbell CD, Prosser JI (2003) Diversity of fungi in organic soils under a moorland - Scots pine (Pinus sylvestris L.) gradient. Environmental Microbiology 5: 1121–1132. Find this article online
  10. Huang A, Li J-W, Shen Z-Q, Wang X-W, Jin M (2006) High-throughput identification of clinical pathogenic fungi by hybridization to an oligonucleotide microarray. Journal of Clinical Microbiology 44: 3299–3305. Find this article online
  11. Sweet MJ, Croquer A, Bythell JC (2010) Temporal and spatial patterns in waterborne bacterial communities of an island reef system. Aquatic Microbial Ecology 61: 1–11. Find this article online
  12. Sanchez O, Gasol JM, Massana R, Mas J, Pedros-Alio C (2007) Comparison of different denaturing gradient gel electrophoresis primer sets for the study of marine bacterioplankton communities. Applied and Environmental Microbiology 73: 5962–5967. Find this article online
  13. Muyzer G, Smalla K (1998) Application of denaturing gradient gel electrophoresis (DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial ecology. Antonie Van Leeuwenhoek International Journal of General and Molecular Microbiology 73: 127–141. Find this article online
  14. Bythell JC, Barer MR, Cooney RP, Guest JR, O'Donnell AG, et al. (2002) Histopathological methods for the investigation of microbial communities associated with disease lesions in reef corals. Letters in Applied Microbiology 34: 359–364. Find this article online
  15. Porchethennere E, Vernet G (1992) Cellular-immunity in an annelid (Nereis diversicolor, Polychaeta) - Production of melanin by a subpopulation of granulocytes. Cell and Tissue Research 269: 167–174. Find this article online
  16. Gimenez-Conti I, Woodhead AD, Harshbarger JC, Kazianis S, Setlow RB, et al. (2001) A proposed classification scheme for Xiphophorus melanomas based on histopathologic analyses. Marine Biotechnology 3: S100–S106. Find this article online
  17. Casadevall A, Pirofski LA (2000) Host-pathogen interactions: Basic concepts of microbial commensalism, colonization, infection, and disease. Infection and Immunity 68: 6511–6518. Find this article online
  18. Altinok I, Kurt I (2003) Molecular diagnosis of fish diseases: a review. Turkish Journal of Fisheries and Aquatic Sciences 3: 131–138. Find this article online
  19. Sweet MJ, Bythell J (2012) Ciliate and bacterial communities associated with White Syndrome and Brown Band Disease in reef building corals. Environ Microbiol DOI: 10.1111/j.1462-2920.2012.02746.
  20. Cooney RP, Pantos O, Le Tissier MDA, Barer MR, O'Donnell AG, et al. (2002) Characterization of the bacterial consortium associated with black band disease in coral using molecular microbiological techniques. Environmental Microbiology 4: 401–413. Find this article online
  21. Pantos O, Cooney RP, Le Tissier MDA, Barer MR, O'Donnell AG, et al. (2003) The bacterial ecology of a plague-like disease affecting the Caribbean coral Montastrea annularis. Environmental Microbiology 5: 370–382. Find this article online
  22. Fernandez AA, Bowser PR (2008) Two cases of non-hybrid melanoma formation in Xiphophorus nezahualcoyotl Rauchenberger, Kallmann & Morizot. Journal of Fish Biology 72: 292–300. Find this article online
  23. Schartl A, Malitschek B, Kazianis S, Borowsky R, Schartl M (1995) Spontaneous melanoma formation in nonhybrid Xiphophorus. Cancer Research 55: 159–165. Find this article online
  24. Huang PH, Marais R (2009) CANCER Melanoma troops massed. Nature 459: 336–337. Find this article online
  25. Albor A, Kulesz-Martin M (2007) Novel initiation genes in squamous cell carcinomagenesis: A role for substrate-specific ubiquitylation in the control of cell survival. Molecular Carcinogenesis 46: 585–590. Find this article online
  26. Wu J-b, Guan D-x, Yuan F-h, Zhang X-j (2009) Research advances on the biological effects of elevated ultraviolet-B radiation on terrestrial plants. Journal of Forestry Research (Harbin) 20: 383–390. Find this article online
  27. Smith RC, Prezelin BB, Baker KS, Bidigare RR, Boucher NP, et al. (1992) Ozone depletion - Ultraviolet radiation and phytoplankton biology in Antarctic waters. Science 255: 952–959. Find this article online
  28. Haeder DP, Helbling EW, Williamson CE, Worrest RC (2011) Effects of UV radiation on aquatic ecosystems and interactions with climate change. Photochemical & Photobiological Sciences 10: 242–260. Find this article online
  29. Dahms H-U, Lee J-S (2010) UV radiation in marine ectotherms: Molecular effects and responses. Aquatic Toxicology 97: 3–14. Find this article online
  30. Lowe C, GoodmanLowe G (1996) Suntanning in hammerhead sharks. Nature 383: 677–677. Find this article online
  31. Vielkind J, Haas-Andela H, Anders F (1978) Characterization of the genetic factors involved in melanoma formation in xiphophorine fish, by transformation experiments. Verhandlungen der Deutschen Zoologischen Gesellschaft 71: 228. Find this article online
  32. Fernandez A, Paniker L, Garcia R, Mitchell D (2011) Recent advances in sunlight-induced carcinogenesis using the Xiphophorus melanoma model. Comparative Biochemistry and Physiology Part C Find this article online
  33. Patton EE, Nairn RS (2010) Xmrk in medaka: A new genetic melanoma model. Journal of Investigative Dermatology 130: 14–17. Find this article online
  34. Regneri J, Schartl M (2012) Expression regulation triggers oncogenicity of xmrk alleles in the Xiphophorus melanoma system. Comparative Biochemistry and Physiology - C Toxicology and Pharmacology 155: 71–80. Find this article online
  35. Jones GP, Milicich MJ, Emslie MJ, Lunow C (1999) Self-recruitment in a coral reef fish population. Nature 402: 802–804. Find this article online
  36. Kohout J, Jaskova I, Papousek I, Sediva A, Slechta V (2012) Effects of stocking on the genetic structure of brown trout, Salmo trutta, in Central Europe inferred from mitochondrial and nuclear DNA markers. Fisheries Management and Ecology 19: 252–263. Find this article online
  37. Marie AD, Bernatchez L, Garant D (2012) Environmental factors correlate with hybridization in stocked brook charr (Salvelinus fontinalis). Canadian Journal of Fisheries and Aquatic Sciences 69: 884–893. Find this article online
  38. Frisch A, Van Herwerden L (2006) Field and experimental studies of hybridization between coral trouts, Plectropomus leopardus and Plectropomus maculatus(Serranidae), on the Great Barrier Reef, Australia. Journal of Fish Biology 68: 1013–1025. Find this article online
  39. Sadovy Y (2005) Trouble on the reef: the imperative for managing vulnerable and valuable fisheries. Fish and Fisheries 6: 167–185. Find this article online
  40. Davies H, Bignell GR, Cox C, Stephens P, Edkins S, et al. (2002) Mutations of the BRAF gene in human cancer. Nature 417: 949–954. Find this article online
  41. Hubbard K, Steinberg ML, Hill H, Orlow I (2008) Mitochondrial DNA deletions in skin from melanoma patients. Ethnicity & disease 18: S2. Find this article online
Editors Notes
  • *The authors and their affiliations are:
    Michael Sweet1*, Nigel Kirkham2, Mark Bendall1, Leanne Currey3, John Bythell1,4, and Michelle Heupel5,6
    1 Coral Health and Disease Laboratory, School of Biology, Newcastle Institute for Research on Sustainability, Newcastle University, Newcastle upon Tyne, United Kingdom,
    2 Cellular Pathology, Royal Victoria Infirmary, Newcastle upon Tyne, United Kingdom,
    3 AIMS@JCU, Australian Institute of Marine Science, School of Earth and Environmental Sciences, Fishing and Fisheries Research Centre, James Cook University, Townsville, Australia,
    4 Research Office, University of the South Pacific, Suva, Fiji,
    5 Australian Institute of Marine Science, Townsville, Australia,
    6 Fishing and Fisheries Research Centre, School of Earth and Environmental Sciences, James Cook University, Townsville, Australia
  • Citation: Sweet M, Kirkham N, Bendall M, Currey L, Bythell J, et al. (2012). Evidence of Melanoma in Wild Marine Fish Populations. PLoS ONE 7(8): e41989. doi:10.1371/journal.pone.0041989
  • Editor: Jean-Pierre Vartanian, Institut Pasteur, France
  • Received: May 11, 2012; Accepted: June 27, 2012; Published: August 1, 2012
  • Copyright: © 2012 Sweet et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
  • Funding: The work was funded by a Natural Environment Research Council grant (NE/E006949). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
  • Competing interests: The authors have declared that no competing interests exist.
  • Acknowledgments:The work was conducted under a permit registered to AIMS via GBRMPA with permit No: G10/33440.1. Thanks to Lyndon Llewellyn and Colin Simpfendorfer for reviewing this manuscript before submission and helpful comments and guidance.
  • Author Contributions:Conceived and designed the experiments: MS MH LC. Performed the experiments: MS MH LC MB. Analyzed the data: MS. Contributed reagents/materials/analysis tools: MS JB MH. Wrote the paper: MS JB MH NK.

 

Ecoregions of Colombia

August 8, 2012 - 2:10pm

Colombia has thirty one ecoregions that occur entirely or partly within its borders: [1] Western Ecuador moist forests, [2] South American Pacific mangroves, [3] Chocó-Darién moist forests, [4] Eastern Panamanian montane forests, [5] Amazon-Orinoco-Southern Caribbean mangroves, [6] Magdalena-Urabá moist forests, [7] Guajira-Barranquilla xeric scrub, [8] Sinú Valley dry forests, [9] Santa Marta montane forests, [10] Santa Marta páramo, [11] Cordillera Oriental montane forests, [12] Northern Andean paramo, [13] Magdalena Valley montane forests, [14] Magdalena Valley dry forests, [15] Cauca Valley montane forests, [16] Cauca Valley dry forests, [17] Northwestern Andean montane forests, [18] Patía Valley dry forests, [19] Eastern Cordillera real montane forests, [20] Napo moist forests, [21] Purus varzea, [22] Solimoes-Japura moist forest, [23] Caqueta moist forests, [24] Japurá-Solimoes-Negro moist forests, [25] Negro-Branco moist forests, [26] Rio Negro campinarana, [27] Llanos, [28] Apure-Villavicencio dry forests, and [29] Catatumbo moist forests. And off shore: [30] Cayos Miskitos-San Andrés and Providencia moist forests, and [31] Malpelo Island xeric scrub.

Western Ecuador moist forests

The moist forests of western Ecuador encompass a large part of the Pacific Coast covering a series of plains and small elevation variations that make this ecoregion unique by enhancing its ecological complexity. Located in south western Colombia and western Ecuador, most of this ecoregions moist forests are concentrated in the province of Esmeraldas to the north between the area of San Lorenzo (south of the Colombian Chocó) and Quinindé (Mangoya river). The ecoregions boundaries extend from the Patia River in the north then through the provinces of Manabí and Guayas to the south where it touches the Golfo de Guayaquil, ending among the foothills of the Andes Mountains in the east.

These forests that once covered vast areas of the coastal region and were home to an enormous wealth and diversity of species are now a dispersed chain of remnants under constant threat and facing an uncertain future. These moist forests of western Ecuador previously covered most of the north western Ecuadoran coast, but have now lost more than 1500 kilometers2 (km2) and are continuing to disappear at one of the highest rates in the world.

South American Pacific mangroves
  • Esmeraldes-Pacific Colombia mangroves -  This extensive mangrove ecoregion follows along the Pacific Coasts of Colombia and Ecuador encompassing stands of mangrove ecosystems along the way. Some of the larger stands are found in Tribugo Bay at the northern extent of the ecoregion then working south through the mouth of the San Juan River, Naya River, Guapi River, Mira River, Esmeraldas River finally ending at just south of the Mompiche Bay. The ecoregion generally has two large mangrove zones divided by Cabo Corrientes in Colombia.

    On the continent, Colombia has two Natural National Parks (Sanquianga and Ensenada de Utría) that based on their status as protected areas promote mangrove development and positively reduce the effects of human action on the ecosystem. In addition, positive expectations have been created with the implementation of Civil Society Natural Reserves. Three reserves have been established in northern Colombia and efforts to increase this number are ongoing.

Chocó-Darién moist forests

The ecoregion of the wet forests of Chocó-Darién extends from eastern Panama, in the provinces of Darién and Kuna-Yala, along almost the entire Pacific coast of Colombia, in the departments of Chocó, Cauca, Valle del Cauca, and Nariño. Thus running between latitudes 9º to 1º15’ north, then down to 2°S and longitudes 79º to 76º15’ west. This ecoregion encompasses a strip of land from sea level to an elevation of approximately 1,000 meters (m). It lies between the Pacific Ocean and the western range of the Andes; from west of the mouth of the Atrato River, in Panama to the Patia River, in Colombia.

This moist forest ecoregion is considered one of the most species rich lowland areas in the world, with exceptional abundance and endemism over a broad range of taxons that include plants, birds, amphibians, and butterflies. Its biological distinctiveness is outstanding in the world, with great biological, ecological, and evolutionary biodiversity. Due to the multiple threats in the ecoregion, its conservation status is vulnerable although relatively stable. There are, however threats of habitat conversion and the attendant degradation, in a system of areas with insufficient conservation. In addition, this ecoregion is culturally rich in that numerous indigenous communities with strong ties to its ecosystems still persist here.

The region has great potential for ecotourism and scientific research. Its forests are of great interest because some of them may be secondary forests that are nearly 500 years old, which would clearly allow for studies on the subject of the regeneration of tropical forests. The areas with remaining vegetation correspond to the central area of the ecoregion, while the northern areas of Darién and Urabá, in Colombia are devoted primarily to the production of bananas and cattle ranching. Southern areas of Bajo Calima and Tumaco, are devoted in part to plantations for the production of oil palm and extraction of timber for paper pulp are those that require greater urgency and efforts for their protection and conservation.

Eastern Panamanian montane forests

This ecoregion is found in the highlands of eastern Panama with small extensions into Colombia, and contains montane forests which grow at elevations from 500 to 1,800 m. Located on the land bridge between South and North America, complex forests cover this mountainous region and are home to extremely high diversity and endemism. A number of endemic avifauna inhabit this region, including the acaruna tapaculo, Pierre bush tanager, Pierre warbler, and Tacaruna quail-dove. Parque Nacional Darién, Central America’s largest national park, is found here and protects twenty-four species of endangered herpetofauna. The inaccessibility of the slopes has left much of the region intact, but the extension of the Pan-American Highway has led to an increase in slash-and-burn agriculture, gold mining, and illegal trade in local wildlife.

Amazon-Orinoco-Southern Caribbean mangroves
  • Magdalena-Santa Marta mangroves - Running along the Carribean Sea coast of Colombia this ecoregion is a perfect example of how diverse a mangrove ecosystem can be with species distributions varied throughout the ecoregion depending on the conditions of each patch including the salinity gradient and tidal flux. Species are representative of the surrounding ecoregions such as the Sierra Nevada de Santa Marta montane moist forests and the arid Sinú Valley dry forests as well as mangrove specialists. The avifauna of the ecoregion is compiled by two separate endemic bird areas with at least one endemic hummingbird species and innumerable numbers of migrants. It is located in northern Colombia in the Department of Magdalena encompassing the Gulfo de Urabá then east to just past the Sierra Nevada de Santa Marta at the base of the Guayjira Peninsula, at 10°30' and 11° north latitude.

Magdalena-Urabá moist forests

Located in northern Colombia, these jungles link the northern ecoregions of Mesoamerica and the Chocó with the Andean and Amazonian ecoregions. Extremely rich in both species richness and endemism, this region serves as an important migration point for many avifauna species.

Several areas of considerable size still intact and with little human intervention; around the Serranía de San Lucas is the largest patch. But the conditions and fragmentation of the ecoregion are diverse, depending of the location.

There are many official figures of conservation in this important region; there is not a National Park or alike; several projects with international funds are aimed to rescue some important wetlands, and the establishment of private nature reserves is starting with strong forces in some areas. There are several areas of intact habitat remain such as Serranía de San Lucas.

The region is surrounded by most of the Colombian population and the pressure for the natural resources are tremendous; large scale colonization, cattle ranching, gold mining, oil drilling, valuable timber, narcotic crops, and warfare, together with the extreme pollution of the two most important rivers, the Magdalena and the Cauca, are putting tremendous pressure on these fragile and unique ecosystems.

Guajira-Barranquilla xeric scrub

The Guajira/Barranquilla xeric scrub is located in three enclaves along the Caribbean Sea. The largest enclave is located in the Guajira Peninsula, which is the northernmost point of South America, in both northwestern Venezuela and northeastern Colombia. The enclave extends south between the Sierra Nevada de Santa Marta and the Serrania de Perijá. The second and smallest of the three enclaves is located east of the Santa Marta Bay, in the north of the Magdalena department of Colombia. The third enclave is found in the north of the Cordoba, Sucre, Bolivar and Atlantico departments, along the Caribbean Sea. The largest city in the ecoregion is Barranquilla.

The Guajira/Barranquilla ecoregion is a unique xerophytic area in the neotropics. Proposed as a bird center of endemism, this arid habitat is dominated by thorn scrub. Herpetofauna is particularly rich with sixty-six species including the endangered species Geochelone carbonaria, and Phrynops dahli.

Even though the dry climate in this region does not favor crops, the whole ecoregion has been effected by humans, principally through agriculture and grazing. The southernmost part of the Guajira peninsula has been severely altered by such activities.

There are two important protected areas in the region, Macuira National Park (IUCN Category II) and Tayrona National Park (IUCN Category II). Macuira Park is located in the northeastern side of the Guajira Peninsula. The park has an area of 25,000 hectares (ha.), and is part of the Serranía de Macuira, which is an "island" of dense vegetation different from the surrounding desert. The elevation of the Serranía is 500 masl. The most common species are Acacia farnesiana, Anacardium excelsum, Cardiospermum carindum, Cassia tora, Cephalocereus colombianus, Dodonea viscosa, Fagara sp., Genipa americana, Lemaireocereus griseus, Pristimera vernicosa, Ruperchtia ramiflora The Park has isolated populations of caiman (Caiman crocodylus), ocelot (Leopardus pardalis), margay (Leopardus wiedii), and primates of the genus Alouatta. There are 7 endemic subspecies of birds in the Park.

Tayrona National Park has an area of 150 square kilometers (km2). The Park consists of mangroves and xeric scrubs. The most common species are Capparis odoratissima and Pltymiscium plystachum. The Park has recorded appriximately 100 species of mammals, 200 birds, and 31 species of amphibians. Some of the mammals are jaguar (Felis onca), paca (Cuniculus paca), collared peccary (Tayassu tajacu), red howler monkey (Alouatta seniculus seniculus), and various species of Chiropterans.

Sinú Valley dry forests

For its location at the northwestern extreme of the Andes, near the Darien-Panama bridge and between the two major ecoregions: Chocó wet forests and Magdalena Medio rain forests, the Sinú region is a bridge, a genetic corridor, a contact zone and a center of endemism, and it is strongly believed, a paleo-environment.

Located in the northern sector of Colombia and the South American continent ( between 7° N, 75° W and 10° N, 77° W ), and surrounded by the Magdalena moist forest, the Sinú river flows from the northernmost branches of the western Cordillera of the Andes, towards the Caribbean sea, forming a valley between the Serranías de Abibe and San Jerónimo

The altitudinal gradient, from the upper peaks of the Paramillo, at 3.960 meters (m) above sea level (masl.) to the low alluvial valley at 200 masl. and to the mangroves at sea level, makes it possible for the region to have several types of ecosystems and forests in within a relatively small area.

Due to recent large-scale human intervention, of no more than sixty years, mainly deforestation for cattle ranching and agriculture, damming of the river for large hydroelectric projects, and desiccation of wetlands, very few intact habitat remains in the low valley or in the drier ecosystems, but around it, in the mountains and in the upper Sinú, the forest cover stills present and the presence of a National Park and Indigenous territories assures its conservation.

Wetlands and swamps are at different levels of intervention, but most still in good conditions, until now, when a new dam is filling up in the upper Sinú. The aquatic ecosystems are in need of conservation actions.

Santa Marta montane forests

The Sierra Nevada of Santa Marta montane forest ecoregion lies in northern Colombia between 10° 01’05’’ and 11° 20’11’’ north latitude and 72° 36’16’’ and 74° 12’49’’ east longitude, in the extreme northwest of South America. It is a mountain massif with a pyramid-shape and a surface area of 12,230 km2. On the shores of the Caribbean Sea these mountains rise to an altitude of 5775 m. This ecoregion forms a triangular shape.

This montane ecoregion is a characteristic moist forest; however, it rises from very different habitat of xeric scrub and dry forest that surround it. This ecoregion is limited by altitude running from lowlands to 3300 meters(m) or ending when the vegetative structure changes to paramo, which is then considered the Sierra Marta paramo ecoregion. Parts of the two ecoregions are together in a national park and listed as an endemic bird area by Stattersfield. These monuments and titles further justify the need to protect and recognize this unique habitat and the amount of diversity held within this ecoregion.

Much of this ecoregion has been destroyed leaving about 15% of the original vegetation intact, mainly on the north-facing slopes. Although not much help to this ecoregion it is found within the limits of the Sierra Nevada de Santa Marta National Park and in 1980 the Cogui–Arsario Arhuaco indigenous reserve was created as a strategy for conserving the ecosystems and aboriginal cultures in this territory further. The Sierra Nevada de Santa Marta Biosphere Reserve and Tayrona National Park also hold parts of this ecoregion but offer it little formal protection as areas are continuing to be cleared. The jurisdiction of the indigenous reserve was subsequently expanded so that it now overlays and exceeds the area covered by the National Park.

The mountains of this Sierra ecoregion previously held a settlement of pre-Columbian aboriginal communities that left signs of their presence in various areas. In addition, they have been settled at different times since the late nineteenth century. All of this led to a process that modifies the natural environment. The area covered by mountain forests has declined drastically during the last 50 years. In some cases, it is estimated that the reduction in the original forest is between 70% and 80%.

Santa Marta páramo

This isolated ecoregion in Columbia is found in the Sierra Nevada de Santa Marta.

The southernmost areas of páramos high moors in South America (11° North Latitude) are found in the Sierra Nevada de Santa Marta, an isolated mountain system of the Andes range that rises to 5,775 meters (m) above sea level (m.a.s.l.) on the shores of the Caribbean in northern Colombia. This massif located between 10° 01'05 and 11° 20'11 north latitude and 72° 36'16 and 74° 12'49 west longitude, sits on a base of sub-triangular contours the northern edge of which runs parallel to the coastline. One edge looks to the west facing the Great Swamp de Santa Marta, while the other faces south-southwest to the Perijá mountains, from which it is separated by the valleys of the Cesar and Ranchería rivers.

Due to this isolation, a range of endemic flora and fauna occur here including the genus Cabreriela, Castenedia and Raouliopsis. This ecoregion is included in the jurisdiction of the Sierra Nevada de Santa Marta National Park, however existing cattle grazing and agricultural development by the indigenous people have severely altered the landscape.

The páramos of the Sierra Nevada are included in the jurisdiction of the Sierra Nevada de Santa Marta National Park, which was created in 1964 and now encompasses an area of approximately 383,000 hectares. It is also included in the Cogui-Arsario and Aruhaco indigenous refuges that have special jurisdiction over the territory. However, they are seriously affected by the existence of extensive cattle herds belonging to indigenous communities that reach up to 3800 m above sea level. A large part of the subpáramo or lower limit has been altered by burning to expand the scrublands and establish local potato and onion crops. Communities of small trees or shrubs are altered by extraction of wood for building and firewood, an activity associated with extensive burning on the páramo as such, to expand the scrubland, clearly degrading biological diversity, eliminating the cover of fallen leaves, reducing moisture retention, and promoting erosion on slopes. Cleef and Rangel note that the high coverage of Acaena cylindrostachya and Lupinus carrikeri in some sectors of scrubland seems to indicate a change in the original vegetation, as a result of extensive livestock, modifying the structure of the vegetation.

Cordillera Oriental montane forests

These Andean montane forests span the eastern slopes of the Andean Cordillera Oriental from their northernmost point southwards through most of Colombia. The Cordillera Oriental Montane Forests are clearly distinguishable from the rest of the montane forest ecoregions of the Northern Andes because of the influence of the piedmont dry forests and the Llanos grasslands of the Orinoco basin, as well as species associations shared with the isolated Santa Marta Mountains.

In Colombia, 60% of the original ecosystems of the ecoregion have been altered. In the montane forests of the Macarena Mountains around 17% has been intervened and approximately 60% of the area has been converted. In Venezuela, the degree of habitat loss is unknown but thought to be limited. In the Colombian portion of the ecoregion, Parque Catatumbo – Bari covers some 821 km2, and various indigenous territories cover another 1,746 km2.

Logging, agriculture, and extensive ranching activities, such as in the flatter foothills, have led to fragmentation, while hydroelectric projects and road infrastructure are being developed in some areas continue to threaten the ecoregion.

Northern Andean paramo

This ecoregion occurs in elevational, mountaintop patches between treeline and the permanent snowline, from northern central Colombia, down the Andean Cordillera to Central Ecuador. This is an extensive ecoregion with a diversity of vegetation types within its parameters, however they all share the characteristic páramo vegetation; high alpine grasslands, bunchgrass, bogs, and open meadows. Although these areas have proven resilient to the influence of man, their capacities are being forced to their limit by burning, grazing, and farming.

Magdalena Valley montane forests

The montane forests that grow along the Magdalena river valley, on the inner slopes of the Eastern and Central Cordilleras, of the Northern Andes in Colombia, are very rich both in animal and plant diversity and endemic species. Being the Eastern cordillera of sedimentary origin, due the uprising of the highly volcanic Central cordillera, the soils are very diverse so the forests that grows on them. In the middle of the Magdalena Medio, surrounded by moist forests, rises the Serranía de San Lucas, up to 2,000 meters, little known biologically.

Few areas are still in good condition due to large scale use of the slopes for coffee growing and farming, but also because more than 70% of the Colombian population lives in this region. The best-preserved areas are the upper Magdalena around the Los Guacharos National Park; the slopes of Nevados del Puracé and Huila, and the Serranía de San Lucas. The remaining areas have forest fragments of variable size. Today many canyons, basins and forest fragments have the remaining biodiversity of the region and all of remains are in urgent need of conservation.

There are several parks in the upper Magdalena basin, such as Guácharos, Puracé, Huila, Hermosas, Nevados, Picachos, Sumapaz and Chingaza, that conserve most of the high montane forests, mostly above 3,000 masl, but unfortunately, below 2,000 masl there are few conservation figures or initiatives, besides an insipient movement of nature reserves of the civilian society that is aiming to protect most of the remaining fragments of native forests among a "sea of grasses and exotic conifers and eucalyptus". Besides protecting the remnant fragments of native habitats, forest corridors between fragments, conservation areas and altitudinal gradients should be established.

Magdalena Valley dry forests

This ecoregion, located within the Northern Andes, occurs along the dry inter-Andean valley formed by the Magdalena River, which is the largest in Colombia. The climate is dry and vegetation includes cati such as Armathocereus humilis and Stenocereus griseus. Fauna biodiversity is relatively unknown, but includes a few endemic subspecies such as the burrowing owl (Athene cunicularia tolimae), tropical bobwhite (Colinus cristatus leucotis), and euphonia (Euphonia concinna). Agriculture, and overgrazing, especially from introduced goats, has destroyed much of the original habitat. Major conservation plans are needed to save this ecoregion since there are no national parks.

Today, most of the original forest cover has disappeared due to conversion of these to farmland and cattle-ranching. Only few forest patches still present around the Cabrera river in Tolima and along creeks. Goats were introduced since the XVI century by the Spanish, and their descendants are still roaming today on the vegetation left.

Several oil deposits are present in the region, and the drilling and extraction of it is a cause of pollution around the Tatacoa desert

Cauca Valley montane forests

Located at the northwestern end of the Andes Mountain Range in southwestern Colombia, the Cauca Valley, nestled between the Western and Central ranges of the Andes, stretches for 600 kilometers (km) in a south-north direction between 2° and 8° N latitude.

The montane forests of the Cauca Valley in southwestern Colombia are highly diverse and are an important center of endemism of plants and animals. However, the ecoregion has suffered large losses of forest cover and only small remnants of native vegetation remain, especially at the lower elevations.

The montane forests of the Cauca Valley are strongly fragmented, especially at the lower elevations. Between 1,000 and 2,000 meters (m), most forest has disappeared, and only scattered remnants remain. The largest remaining block within this elevational belt is the Yotoco Forest Reserve, with an extension of 519 hectares (ha). Substantial forest remains at the higher elevations, on both slopes of the valley. However, only small portions receive nominal protection in national parks such as Farallones de Cali, Tatamá, and Los Nevados. Some protection is also afforded by small regional reserves such as Ucumarí Regional Park.

Cauca Valley dry forests

A narrow strip of dry forest is situate in a dry valley of the Cauca River in northwestern Colombia, this ecoregion is one of the most degraded in area. Little is left of the natural vegetation in the valley due to agricultural expansion and urban development. There are many endemics within this region that desperately need protection in order to avoid extinction.

The Sonso Lagoon Reserve is the only protected area located in an ancient oxbow of the Cauca River. The reserve consists of wetlands and forests, and has an area of 2,050 hectares (IUCN category IV). The species found in the reserve are representative of wetlands and gallery forests. There are no protected areas in the dry forests.

Northwestern Andean montane forests

The Northwestern Andean montane forest ecoregion is among the most diverse regions on the planet. The disjunct formation of Andean topography and pronounced glacial period of isolation forced plant and animal communities to adapt to different areas after being cut off from each other; therefore laying the perfect foundation for speciation. For a variety of reasons, related to their complex topography and a biogeographical history featuring continual altitudinal migration of vegetation zones in response to changing climate, these ecosystems today present a diverse array of distinctive biological communities, characterized by unusually high levels of species endemism. This region not only boasts the highest biodiversity, but also the highest percentage of endemic species. About 50% of its flora is found nowhere else, and this area contains the highest concentration of endemic bird areas. Unfortunately, people have found these areas livable and have disturbed these natural areas in many ways since pre-Colombian times. Although some reasonably sized continuous forest stands still exist, patchiness from farms and other anthropogenic influences have disturbed these highly sensitive forests.

Patía Valley dry forests

This small dry inter-Andean Valley in southwestern Colombia flanks the Patía River Valley and vicinity. Completely surrounded by the formidable barrier of the Andean chain, and encompassed by moist and cloud forests, this valley has remained isolated from similar habitats for long enough for speciation to occur among its flora and fauna. Like most of the dry valleys in the Andes, the Patía Valley is threatened by human settlement and urban sprawl.

Today most of the valley has suffered from human activity, but there are pockets with original vegetation that could be preserved; there are some conservation initiatives in private lands that can may conserve a good proportion of the original species. But in general, conservation initiatives are urgently needed in this valley.

If the current trend of use continues, very few original ecosystem could be left for conservation. Promotion of private conservation is one way to save what is left, and there is a Colombian NGO, the Network of Nature Reserves of the Civilian Society that is addressing this challenge.

Eastern Cordillera real montane forests

This tropical montane forest ecoregion is located on the eastern slopes of the middle Andes, extending north-south from southern Colombia, through Ecuador, and into northern Peru. This rugged premontane habitat receives between 1,500-2,000 millimeters (mm) of rain each year, but can get as much as 4,500 in a heavy rain year. The dominant vegetation in this region varies dramatically with altitude, which ranges from 900 meters (m) to over 2100 m. In general, the plant communities here are tropical evergreen seasonal broad-leaved forests. The lower elevational areas, known locally as ceja de montaña, consists of closed, luxuriant forests. As elevation increased forests stature decreases and at higher elevations grades into cloud forests and finally elfin woodlands.. This area is home to several endangered and endemic birds, including the white-necked parakeet, coppery-chested jacamar, and bicoloured antvireo.

These moist montane forests are naturally isolated and have also been fragmented by the clearing away of forests to make way for agriculture and pasture. As access is relatively easy, in recent years these forests have been increasingly more threatened by the removal of valuable commercial species such as Podocarpus. Perhaps 75 percent of the coverage of original wet forest has been removed, having been cut and replaced by agricultural systems or thickets.

Napo moist forests

The Rio Napo region is situated at the western extreme of Amazonia where it hosts extraordinarily rich tropical moist forests. The ecoregion covers the northwestern portion of Peru, the Amazon region of Ecuador and the southwestern corner of Colombia’s Amazon. It is bounded on the west by the foothills of the Andes Mountains, on the south by the Marañon River in Peru, on the north by the Napo in Peru and the Caguán in Colombia. The region extends east almost to the Peruvian City of Iquitos near the confluence of the Napo and Amazon Rivers. Many important Amazon rivers including the Morona, Pastaza, Tigre, and Curaray in Ecuador and Peru, and the headwaters of the Caquetá and Putumayo in Colombia bisect the region. All of these rivers drain into the Amazon Basin.

This ecoregion belongs to the Amazon floristic province, an area of extreme diversity and endemism in species of both flora and fauna. This diversity results in some of the most species-rich forests in the world. For example, below 300 meters (m) elevation there are 138 orchid species that have been identified in Ecuador alone. Much of this ecoregion is not well known by scientists, possibly holding species currently undiscovered with the possibility of increasing worldwide biodiversity.

La Paya National Park in Colombia is situated on the interfluve between the Caquetá and Putumayo Rivers, but its forests and species are under threat from colonization, plantation agriculture, and hunting in and around the reserve. The entire area around La Paya National Park is deforested. The large triangle between the Caguán and Upper Putumayo Rivers in Colombia and the province of Napo in Ecuador at the northern extent of the ecoregion are areas of notable deforestation, resulting from forest conversion to cattle pasture and coca (Erythroxylum coca) plantations. The remaining intact Napo moist forest is considered threatened by degradation resulting from ongoing human activities.

Purus varzea

The flooded river basins of the Amazon make up this ecoregion. Avifauna diversity is extraoridinary with over six hundred and thirty species. Terrestrial mammal diversity is smaller because the habitat is often flooded; two narrow endemic primates inhabit this region, the white uakari monkeys (Cacajao calvus calvus) and blackish squirrel monkeys (Saimiri vanzolinii) . Also, the largest snake in the world, the great anaconda (Eunectes murinus), is found here. Much of the ecoregion is effected by human presence, because of the waterways used for transportation.

Solimoes-Japura moist forest

The Solimões-Japurá moist forest ecoregion lies on well-drained upland Tertiary alluvial plains in western Amazonia. The region straddles the Putumayo River which forms the Peru-Colombia border north extending to the Caquetá River in Colombia and south to the Amazon and Napo Rivers in Peru. The eastern flank covers the interfluve between the Japurá (Caquetá) and Solimões (Amazon) Rivers in Brazil. The western extent of the ecoregion is well before the lowest foothills of the Andes near Puerto Laguízamo, Colombia.

This rolling terrain on the plains of western Amazonia is high in biodiversity. Avifauna diversity is extremely high with 542 species, including restricted range species such as the blue-tufted starthroats (Heliomaster furcifer), and the endemic ochre-striped antpittas (Grallaria dignissima). The largest freshwater turtle in the world (Podocnemys expansa) inhabits the rivers of this region. Much of the native habitat in this ecoregion remains intact, but recent advances of coca (Erythroxylum coca) production, logging and mining operations, and cattle ranching have damaged huge tracks of land.

About one-third of this ecoregion, in Colombia between the Putumayo and Caquetá Rivers, is under the jurisdiction of indigenous people who practice extractive activities and small-scale shifting cultivation. Although Colombia has strong legislation to regulate timber extraction from these forests, enforcement suffers because of insufficient administrative capacity.

Caqueta moist forests

The Caquetá moist forest occurs in the Colombian Amazon. It is bound on the northeast by the Guainía, Guaviare, and Guayabero rivers and to the western extreme at the small Rio Losada, south of the Serrania de la Macarena. The southern border of the region extends southeast from the headwaters of the Rio Caguan, which then converges with the Caquetá. The region extends east just into Brazil. The Apaporis, Vaupés, and Yari rivers dissect this region, and large expanses of seasonally flooded forest occur on their banks.

Located in the Colombian Amazon and high in rainfall, flora diversity is rich as is a transitional area between these floristic provinces of the Amazon Basin forests and the Guayana region. Fauna diversity is high although endemism is not. A few species that are endemic include the Chiribiquete emerald (Chlorostilbon olivaresi) and grey-legged tinamou (Crypturellus duidae), and tamarin (Saguinus inustus). Large-scale cattle ranching poses the most serious threat to this ecoregion. Large tracts of forest have been logged to cultivate pastures for grazing.

Large-scale cattle ranching in the western extreme of this ecoregion at the headwaters of the Vaupés River has resulted in the clearing of vast expanses of forestland. A large triangle of deforestation has occurred, fanning out from the San Jose-Calamar road south of the Rio Guayabero. In the interior of the region small settlements of indigenous people have little impact on the natural habitat; however, colonists are now migrating down the Rio Negro, deforesting along the way for small-scale agriculture or cattle grazing. Large forested areas along the Vaupés and Apaporis rivers are also falling to coca (Erythroxylum coca) production. The one protected area in this region is the 8,550 square kilometers Nukak Tuhahi National Reserve in the center. The remaining intact forest is considered threatened frontier forest that may eventually be degraded by ongoing human activities.

Japurá-Solimoes-Negro moist forests

This region of dense tropical rain forest is situated on the lowland plateau in the central northern portion of the Amazon Basin in Brazil with tiny sections just touching Colombia and Venezuela. This tropical rainforest in the northern Amazon Basin is dissected by rivers. Biodiversity is high and includes a number of primates such as black spider monkeys (Ateles paniscus), red-handed tamarins (Saguinus midas), and common squirrel monkeys (Saimiri sciureus). This ecoregion contains the largest national park in Brazil, Jaú National Park. Although much of this habitat has remained intact, areas along the rivers have high levels of mining, logging, agriculture, hunting, and fishing.

Negro-Branco moist forests

The Negro-Branco ecoregion abuts to the northern banks of the Rio Negro, along the southwestern edge of the Guayana Shield in eastern Colombia, southwestern Venezuela, and northwestern Brazil. This area consists of forested lowland plains, with some wide, rolling hill-lands, and low sandstone table mountains. This area hosts diverse plant communities, including both seasonally flooded and non-flooded tall evergreen lowland forests, that can reach 40 meters (m) in height, as well as low evergreen flooded palm forests, which reach only 20 m in height. Elevations range from 120 m-400 m and annual precipitation is between 2,000-3,000 millimeters (mm).

Due to the inaccessibility of this ecoregion, the forest remains largely intact. No paved roads exist here although unpaved roads exist to the north and west of the ecoregion in Colombia. People living in settlements along the rivers practice small-scale rotational agriculture, and boat traffic along the rivers brings loggers and merchants. Brazil nut collectors set fire to the lower portion of the forest as a management practice. This alters the understory in some stands, but this is a localized practice. The largest biosphere reserve in the tropics, the Alto Orinoco-Casiquiare Biosphere Reserve, lies mostly in this ecoregion.

Rio Negro campinarana

The Rio Negro Campinarana ecoregion occur in isolated patches along the Rio Negro and Rio Branco basins in northern Brazil. These isolated patches of oligotrophic, or low nutrient, soils host a range of vegetation types from herbaceous savannas to closed-canopy forests. Patches of similar vegetation occur in northern Peru, southwestern Venezuela, and eastern Colombia as well. Campinarana habitat is very unique with vegetation adapted to extremely poor soil types, leading to a high number of endemic species. There are multiple vegetative layers in this one ecoregion, moving from herbaceous savannas with lichens and grasses through stages to trees and forests. With this structure comes a wide variety of primitive faunal species including at least four species of primates and plant species that are exclusive to the compinarana ecoregion.

Llanos

The llanos ecoregion covers a large elongated area 1,200-1,300 kilometers (km) long, that extends in a gentle curve in a northeast direction, beginning at the foothills of the Oriental Andes of Colombia and extending along the course of the Orinoco River almost to its delta at the sea. The Llanos ecoregion is located in a great depression, limited by the Andes in the west, the Venezuelan coastal range that isolates it from the Caribbean Sea in the north, and the Guiana shield in the south. In Colombia they occupy the departments of Meta, Arauca, Vichada, and Casanare, and continue in Venezuela in the states of Apure, Barinas, Portuguesa, Cojedes, Guarico, Anzoategui, and Monagas. The area of the lowlands of Colombia and Apure State collects the rainfall from the Andes and the Guiana plateau and draining, due to the presence of a slight downward slope in the north-east direction, through the Meta, Arauca, Vichada, Cinaruco, Apure, and Capanaparo Rivers, just to name a few, to the Orinoco River.

In South America the savanna ecosystem covers a total of 269 million hectares (ha.) Most of it (76%) belongs to the Cerrados of Brazil but about 11% (28 million ha) form the Venezuelan Llanos and 6% (16-17 million ha) the "Llanos Orientales" of Colombia. These two areas, although belonging to different countries, form a single ecoregion, the Llanos of the Orinoquia (latitude 3° to 10° N and longitude 62° to 74° W). This is an area of extensive plains, covered mainly by savanna vegetation, of great economic importance for both countries. This ecoregion is relatively young, perhaps less than 10,000 years old, and developed in a great geosyncline between the Guiana Plateau and the Andes Range. This extensive basin was, over time, filled with sediments from the Guiana Plateau and the cordilleras during the Tertiary. The ecoregion then experienced a series of subsidences resulting in a landscape made up mainly of alluvial plains and highlands.

A total of 1.2 million ha are protected in the Colombian Orinoquia as National Parks of "Cordillera de Los Picachos", "El Tuparro" and "Tinigua".

Apure-Villavicencio dry forests

The Apure/Villavicencio dry forests extend southwest, bordering the eastern Cordillera de Mérida, from Venezuela to the Serranía de Macarena in Colombia. The ecoregion is located in the states of Portuguesa, Barinas, and Apure in Venezuela and the departments of Arauca, Casanare, and Meta in Colombia. The ecoregion is wide in the north and narrows as it extends southward.

This transitional habitat is located between the montane forests of the eastern Andean slope and the lowland grasslands. The ecoregion is a mosaic of premontane forest, dry forest, savanna, and gallery forest. Small mammals are characteristic of area and include a mouse opossum (Marmosa xerophila), a vesper mouse (Calomys hummelincki) and the giant anteater (Myrmecophaga tridactyla). Only two parks, the Serranía de la Macarena and Tinigua National Parks, are located within this ecoregion that as been almost destroyed by agriculture and livestock grazing.

Most of the area has been highly degraded by agriculture and livestock grazing. In Venezuela, the agricultural lands are in the north of the ecoregion. In Colombia, the agricultural lands extend throughout the ecoregion, except for some natural habitat remaining in the lowlands of the Serranía de la Macarena and Tinigua National Parks. These two Parks are the only protected areas located in the southernmost part of the ecoregion.

Catatumbo moist forests

The Catatumbo moist forests exist as four distinct enclaves within the Catatumbo Valley, in both northwestern Venezuela and northeastern Colombia.

The Catatumbo moist forests are among the richest in floral diversity in humid tropical areas of Venezuela. These forests flank the lower slopes and lowlands between the Cordillera de Mérida and the Cordillera Oriental of the northern Andes, and occur as several outliers in the vicinity of Lake Maracaibo.

Cayos Miskitos-San Andrés and Providencia moist forests

The islands of San Andrés (the southernmost, at 12º36’N-81º42’W, with a surface area of 24 km2), Santa Catalina and Providencia (the northernmost, at 13º23’N-81º22’W, with a surface area of approximately 17 km2) and a group of keys and small islands, are located 150 km east of the Nicaraguan coast (Bluefields) and 620 km northwest of Cartagena (Colombia). The Miskitos Keys, with more than 85 islands, are located 40 km east of Awas Tara (northeastern Nicaraguan coast on the Caribbean) at 14º26’N-82º50’W and cover a total area of 500 km2, i.e., each key has an average area of some 6 km2.

Moist forests of the Cayos Mistitos / San Andés and Providencia islands form this ecoregion, and cover an area of some 96 square kilometers (km2). This region forms part of the Colombian territory and the greatest source of income is tourism; in addition to coconut production in San Andrés and citrus fruit, particularly oranges in Providencia. Due to deforestation associated with agriculture in San Andrés and intense cattle raising in Providencia, the tropical rain forests which once covered most of the islands are now almost completely destroyed. There are, however, two species of land birds and reptiles that are endemic to San Andrés Island and have managed to survive the vegetative destruction.

Malpelo Island xeric scrub

Malpelo Island (3¸59'05N - 81¸35'28W) is a small isolated Pacific island, 270 miles to the west of Colombia and south of Panama. It is one of several oceanic islands in the eastern tropical Pacific, along with Cocos Island and the Galapagos. The main island itself is roughly 8 square kilometers (km2), its elongate shape is 2.5 kilometers (km) long and 800m wide at its widest point, and is surrounded by a number of smaller rock outcroppings.

Malpelo, a small isolated Pacific island, is host to several endemic plants, a number of breeding seabirds, a land crab, and two endemic species of lizards. Much of the island’s perimeter consists of near vertical rock faces which reach 60 to 230 meters (m) above the sea - making access very difficult. Malpelo was uninhabited until 1986 when a small military garrison was established. Because the island is seldom visited, little is know of its natural history.

The terrestrial species on Malpelo Island remain in relatively good condition. That is to say no exotic species have thus far been introduced, no permanent human habitations exist, and the island is otherwise unchanged by mankind. A military garrison is in place on the island and houses several people at any given time. At present, Malpelo Island is recognized as a Fauna and Floa Sanctuary.

Context

Ecoregions are areas that:

[1] share a large majority of their species and ecological dynamics;
[2] share similar environmental conditions; and,
[3] interact ecologically in ways that are critical for their long-term persistence.

Scientists at the World Wildlife Fund (WWF), have established a classification system that divides the world in 867 terrestrial ecoregions, 426 freshwater ecoregions and 229 marine ecoregions that reflect the distribution of a broad range of fauna and flora across the entire planet.

 

Estimation of adult human biomass

August 7, 2012 - 2:00pm

The energy requirement of species at each trophic level is a function of the number of organisms and their average mass. The study estimates global human biomass, its distribution by region and the proportion of biomass due to overweight and obesity.

This article, written by Sarah C Walpole, David Prieto-Merino, Phil Edwards, John Cleland, Gretchen Stevens and Ian Roberts* appeared first in BioMed Central: Public Health—an open access, peer-reviewed journal that considers articles on the epidemiology of disease and the understanding of all aspects of public health.

The article is a verbatim version of the original and is not available for edits or additions by Encyclopedia of Earth editors or authors. Companion articles on the same topic that are editable may exist within the Encyclopedia of Earth.

The weight of nations: an estimation of adult human biomass Abstract Background

The energy requirement of species at each trophic level in an ecological pyramid is a function of the number of organisms and their average mass. Regarding human populations, although considerable attention is given to estimating the number of people, much less is given to estimating average mass, despite evidence that average body mass is increasing. We estimate global human biomass, its distribution by region and the proportion of biomass due to overweight and obesity.

Methods

For each country we used data on body mass index (BMI) and height distribution to estimate average adult body mass. We calculated total biomass as the product of population size and average body mass. We estimated the percentage of the population that is overweight (BMI > 25) and obese (BMI > 30) and the biomass due to overweight and obesity.

Results

In 2005, global adult human biomass was approximately 287 million tonnes, of which 15 million tonnes were due to overweight (BMI > 25), a mass equivalent to that of 242 million people of average body mass (5% of global human biomass). Biomass due to obesity was 3.5 million tonnes, the mass equivalent of 56 million people of average body mass (1.2% of human biomass). North America has 6% of the world population but 34% of biomass due to obesity. Asia has 61% of the world population but 13% of biomass due to obesity. One tonne of human biomass corresponds to approximately 12 adults in North America and 17 adults in Asia. If all countries had the BMI distribution of the USA, the increase in human biomass of 58 million tonnes would be equivalent in mass to an extra 935 million people of average body mass, and have energy requirements equivalent to that of 473 million adults.

Conclusions

Increasing population fatness could have the same implications for world food energy demands as an extra half a billion people living on the earth.


Background

Thomas Malthus’ Essay on the Principle of Population warned that population increase would eventually outstrip food supply, resulting in famine [1]. Malthus expressed his concern at a time when the amount of food energy that could be harvested from a given amount of land was constrained by the available agricultural technologies. The Green Revolution of the twentieth century challenged Malthus’ grim predictions, as fossil fuel-based fertilizers, pesticides, irrigation and mechanization greatly increased food yields [2]. In the twenty first century, the link between population and ecological sustainability is again coming to the fore, as global food yields are threatened by ecological destruction (including climate change) and as world population grows [2].

The energy requirement of species at each trophic level in an ecological pyramid is a function of the number of organisms and their average mass. In ecology, these factors are often considered together by estimating species biomass, the total mass of living organisms in an ecosystem. In relation to human populations, although much attention is given to the effect of population growth on food energy requirements, much less attention is given to the impact of increasing body mass.

Physical activity accounts for 25-50% of human energy expenditure. Due to the greater energy cost of moving a heavier body, energy use increases with body mass [3]. Resting energy expenditure also increases with body mass, due to the increase in metabolically active lean tissue that accompanies increases in body fat [4]. As for other organisms, the energy requirements of human populations depend on species biomass. Currently, more than a billion adults are overweight and in all regions of the world,, the entire population distribution of body mass is moving upwards [5].

The increased global demand for food arising from the increase in body mass is likely to contribute to higher food prices. Because of the greater purchasing power of more affluent nations (who also have higher average body mass), the worst effects of increasing food prices will be experienced by the world’s poor. In this article, we estimate total human biomass, its distribution by world region and the proportion of human biomass attributable to overweight and obesity.

Methods Data sources

For each country, we obtained estimates of the population in 2005 by age and sex from the United Nations population database [6]. We obtained estimates of mean (and SD) body mass index (BMI) from the WHO SURF2 report [7] and estimates of mean height (and SD) for 190 countries from national health examination surveys, primarily the Demographic and Health Surveys[5]. Because surveys were not conducted in every country, height data were not available by age and sex in some countries. To estimate mean height (and SD) by age and sex in every country using the available data, we built a linear regression model (of age-sex group, average height, WHO region and sub-region) using R open access statistical software. Some countries and territories were excluded from the analysis due to insufficient data on BMI (see Table 1 for a list of these).

Table 1. List of excluded countries due to insufficient data on BMI. Click for Full Image.
Biomass estimation

Total biomass by age-sex group was estimated as the product of the number of people in the group and their average body mass. The formulae for the estimation of body mass are given in the appendix. We also estimated total biomass due to overweight in each age-sex group. We assumed that BMI is normally distributed in the group and estimated the number of people overweight (using prevalence of BMI > 25) and their average BMI. Using their average BMI, we then estimated their average body mass. The biomass of overweight people was calculated as the product of the number of overweight people and their average body mass. Biomass due to overweight was calculated by estimating the biomass of overweight people assuming they had BMI of 25 and subtracting this from their actual biomass. Using a similar method we estimated the biomass due to obesity. We calculated the total biomass of obese people in each age-sex group and subtracted their estimated biomass assuming that they all had a BMI of 30. For each country, we calculated total human biomass, biomass due to overweight and biomass due to obesity by adding the estimates for each age-sex group. Global totals were calculated by summating across countries.

Extreme case scenarios

We estimated global biomass under two hypothetical scenarios. Specifically, we assumed that each country had the same BMI distributions as that of [1] Japan and [2] USA. We used the method outlined above but applied the BMI of the relevant age-sex group from Japan or USA instead of the actual BMI for that age-sex group. These countries were chosen because despite being high income countries with adequate nutrition, they have average BMI values close to global extremes. For each scenario, we calculated the global biomass and biomass due to overweight and obesity.

Population and energy equivalents

We calculated the food energy required to sustain human biomass using formulae and values from the FAO [8]. Physical Activity Level (PAL) values for each age-sex group are based on non-overweight adults in the USA. Total Energy Expenditure (TEE) is estimated as the product of Basal Metabolic Rate (BMR) and PAL (see Table 2). The energy required to sustain the biomass due to overweight, obesity or the change in biomass that would be seen under hypothetical scenarios, was estimated by multiplying the number of kg by weight dependent component of BMR and by the PAL. We did all calculations by country and age-sex group applying the corresponding coefficients. Then we summed across age-sex groups to obtain total energy requirements for each country and for the world. To calculate the number of average adults that could be sustained with a given quantity of biomass we divided the amount of energy required to sustain that biomass by the average food energy requirement of one human.

Table 2. Estimation of Basal Metabolic Rate (BMR) and Total Energy Expenditure (TEE) using FAO tables. Click for Full Image.

Results

In 2005, total adult human biomass was approximately 287 million tonnes (Table 3). Biomass due to overweight was 15 million tonnes, the mass equivalent of 242 million people of average body mass (approximately 5% of the world’s population in 2005). Biomass due to obesity was 3.5 million tonnes, the mass equivalent of 56 million people of average body mass (1.2% of the world’s population). Average body mass globally was 62 kg.

Table 3. Population, body mass and biomass by world region in 2005 and in hypothetical scenarios. Click for Full Image.


North America has the highest average body mass of any continent (80.7 kg). In North America one tonne of human biomass corresponds to 12 adults. More than 70% of the North American population is overweight and biomass due to obesity is 1.2 million tonnes. North America has 6% of the world’s population but 34% of world biomass due to obesity. Asia has the lowest average body mass of any continent (57.7 kg). In Asia, one tonne of human biomass corresponds to 17 adults. Asia has 61% of the world’s population but 13% of world biomass due to obesity (449 thousand tonnes).

The average BMI in Japan in 2005 was 22.9. If all countries had the same age-sex BMI distribution as Japan, total biomass would fall by 14.6 million tonnes, a 5% reduction in global biomass or the mass equivalent of 235 million people of world average body mass in 2005. This reduction in biomass would decrease energy requirements by an average of 59 kcal/day per adult living on the planet, which is equivalent to the energy requirement of 107 million adults. Biomass due to obesity would be reduced by 93%.

The average BMI in USA in 2005 was 28.7. If all countries had the same age-sex BMI distribution as the USA, total human biomass would increase by 58 million tonnes, a 20% increase in global biomass and the equivalent of 935 million people of world average body mass in 2005. This increase in biomass would increase energy requirements by 261 kcal/day/adult, which is equivalent to the energy requirement of 473 million adults. Biomass due to obesity would increase by 434%.

Figure 1 shows the distribution of biomass due to obesity for countries with more than 1% of total human biomass. The two scenarios are also reflected. If China had the same BMI distribution as the USA its biomass due only to obesity would be equivalent to 121% of the world total of biomass due to obesity in 2005.

Figure 1. Human biomass due to BMI > 30 (Countries with more than 1% of human biomass due to BMI > 30). Click for Full Image.


The energy required to maintain obese biomass corresponds to the energy requirements of 24 million adults of world average body mass (Table 4). The energy required to maintain overweight biomass corresponds to the energy requirements of 111 million average adults. In the United States alone, the energy required to maintain overweight biomass corresponds to the energy requirements of 23 million adults of world average body mass (Table 4). If all countries had the same BMI distribution as USA, the energy required to maintain obese biomass would increase by 481%, corresponding to the energy requirements of 137 million adults. Under this scenario, the energy required to maintain overweight biomass corresponds to the energy requirements of 406 million adults.

Table 4. Adults per tonne biomass and energy used to maintain overweight and obesity. Click for Full Image.


Discussion

We estimated global human biomass, its regional distribution and biomass attributable to overweight and obesity. Our results underscore the need to take body mass into account when considering the ecological implications of population growth. UN world population projections suggest that by 2050 there could be an additional 2.3 billion people. [6] The ecological implications of rising population numbers will be exacerbated by increases in average body mass.

Although the largest increase in population numbers is expected in Asia and sub-Saharan Africa, our results suggest that population increases in the USA will carry more weight than would be implied by numbers alone. It is predicted that the US population will increase from 310 million in 2010 to 403 million by 2050 [5]. Most of the increase will be due to migration and to the extent that migrants adopt the diet and lifestyles of the host population, we can reasonably expect that the body mass of migrants will rise. Our results show that this could have important implications for world energy requirements.

In Africa and Asia urban populations are increasing more rapidly than rural populations [9]. This will also have implications for average body mass [10]. Given the current trend of rising BMI, our scenario where all countries have a similar BMI distribution to the USA provides an insight into possible future challenges. If global biomass were to increase to a level where all countries had the age-sex BMI distributions of the USA, the biomass increase would be equivalent to an extra billion people of average body mass. Although, this is not the same as an extra billion people in terms of energy requirements, the increase corresponds to the energy requirements of about 473 million adults of current world average body mass.

Our findings should be viewed in the light of the following limitations. Firstly, in countries where data on average BMI, height and its standard deviation were unavailable, we used a regression model to estimate the missing parameters. Due to limited data availability, we assumed that height and BMI are independent variables, and that the mean and standard deviation of height are the same across the distribution of BMI. Furthermore, because of the lack of data describing the distribution of BMI in relation to high, we assumed zero covariance between BMI and height squared. Secondly, we assumed symmetrical (normal) distributions of BMI in each population, when in reality many population distributions will be skewed, with a tail to the right of the distribution comprising a relatively small proportion of people with very high body mass. We may therefore have underestimated total biomass. Finally, we did not estimate biomass in children who comprise a significant proportion of the population in many countries, nor in countries with population less than 100,000. Future work in this area should account for population age structure, as well as education levels and urbanisation.

There are also limitations in our estimates of energy requirements. We have used FAO data to estimate the BMR but the extent to which they can be applied to all populations is open to question. The assumption of similar physical activity levels in all countries is clearly unrealistic with higher physical activity levels in low income countries. As a result, we will have underestimated energy requirements in some countries. However, this approach is appropriate for comparing different scenarios of BMI distribution and its implications on relative changes in energy requirements.

Conclusions

Increasing biomass will have important implications for global resource requirements, including food demand, and the overall ecological footprint of our species. Future work will investigate the extent to which food demand and carbon emissions are likely to increase with increasing biomass.

Although the concept of biomass is rarely applied to the human species, the ecological implications of increasing body mass are significant and ought to be taken into account when evaluating future trends and planning for future resource challenges. Our scenarios suggest that global trends of increasing body mass will have important resource implications and that unchecked, increasing BMI could have the same implications for world energy requirements as an extra 473 million people. Tackling population fatness may be critical to world food security and ecological sustainability.

References
  1. Malthus TR: An Essay on the Principle of Population. John Murray, London; 1826. Library of Economics and Liberty
  2. The Royal Society: Reaping the benefits: Science and the sustainable intensification of global agriculture. The Royal Society, London; 2009.
  3. Prentice AM, Black AE, Coward WA, Cole TJ: Energy expenditure in overweight and obese adults in affluent societies: an analysis of 319 doubly-labelled water measurements.  Eur J Clin Nutr 1996, 50:93-97.
  4. Schofield WN: Predicting basal metabolic rate, new standards and review of previous work.  Hum Nutr Clin Nutr 1985, 39(Suppl 1):5-41.
  5. Finucaine MM, Stevens GA, Cowan MJ, Danaei G, Lin JK, et al.: National, regional, and global trends in body-mass index since 1980: systematic analysis of health examination surveys and epidemiological studies with 960 country-years and 9.1 million participants. Lancet 2011, 377:557-567.
  6. United Nations Department of Economic and Social Affairs Population Division: World Population Prospects: The 2010 Revision, CD-ROM Edition. UN; 2011.
  7. WHO Global Infobase Team: The SuRF report 2. Surveillance of chronic disease risk factors: country-level data and comparable estimates. World Health Organization, Geneva; 2005.
  8. FAO: Human energy requirements: Report of a Joint FAO/WHO/UNU Expert Consultation. Rome, Rome; 17–24 October 2001.
  9. United Nations: World Urbanisation Prospects: The 2009 Revision. Department of Economic and Social Affairs, Population Division, New York; 2010.
  10. Fezeu LK, Assah FK, Balkau B, Mbanya DS, Kengne AP, Awah PK, Mbanya JCN: Ten-year changes in central obesity and BMI in rural and urban Cameroon. Obesity 2008, 16(5):1144-1147.
Editor's Notes
  • *The Authors are Sarah C Walpole1*, David Prieto-Merino2, Phil Edwards2, John Cleland2, Gretchen Stevens3 and Ian Roberts2. * Corresponding author: Sarah C Walpole argotomunky@yahoo.co.uk
  • Author Affiliations:
    1 Foundation Year 2 doctor, North Yorkshire and East Coast deanery, 4 Hilton Place, Leeds, LS8 4HE, UK;
    2 Faculty of Epidemiology and Population Health, London School of Hygiene & Tropical Medicine, Keppel Street, London, WC1E 7HT, UK;
    3 Department of Health Statistics and Informatics, World Health Organization, 20 Avenue Appia, Geneva 27, 1211, Switzerland.
  • Citation: BMC Public Health 2012, 12:439 doi:10.1186/1471-2458-12-439
    The electronic version of this article is the complete one and can be found online at:
    http://www.biomedcentral.com/1471-2458/12/439
  • Competing interests: The authors declare that they have no competing interests.
  • Authors’ contributions:
    GS is a staff member of WHO. The author alone is responsible for the views expressed in this publication and they do not necessarily represent the decisions, policy, or views of WHO. IR devised the study; SW, DP and PE conducted the analyses with input from GS; and all authors contributed to writing and revising the manuscript. All authors read and approved the final manuscript.
  • Acknowledgements: We thank Marc Levy and Kate Jones for comments on an earlier draft.
  • © 2012 Walpole et al.; licensee BioMed Central Ltd.
  • This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
     
  • Also, in the Encyclopedia of Earth see: Obesogens: Environmental Link to Obesity?

Ecoregions of Chad

August 7, 2012 - 2:00pm

Chad has seven ecoregions that occur entirely or partly within its borders:

  1. East Sudanian savanna
  2. Sahelian Acacia savanna
  3. Lake Chad flooded savanna
  4. East Saharan montane xeric woodlands
  5. South Saharan steppe and woodlands
  6. Sahara desert
  7. Tibesti-Jebel Uweinat montane xeric woodlands
East Sudanian savanna

This ecoregion lies south of the Sahel in central and eastern Africa, and is divided into a western block and an eastern block by the Sudd swamps in the Saharan Flooded Grasslands ecoregion. The western block stretches from the Nigeria/Cameroon border through Chad and the Central African Republic to western Sudan. The eastern block is found in eastern Sudan, Eritrea, and the low-lying parts of western Ethiopia, and also extends south through southern Sudan, into northwestern Uganda, and marginally into the Democratic Republic of Congo around Lake Albert.

The East Sudanian Savanna is a hot, dry, wooded savanna composed mainly of Combretum and Terminalia shrub and tree species and tall elephant grass (Pennisetum purpureum). The habitat has been adversely affected by agricultural activities, fire, clearance for wood and charcoal, but large blocks of relatively intact habitat remain even outside protected areas. Populations of some of the larger mammal species have been reduced by hunting, but good numbers of others remain. Although numerous protected areas exist, most are under-resourced "paper parks" with little active enforcement on the ground, and some have suffered from decades of political instability and civil unrest. The poor infrastructure and inaccessibility of the region have resulted in little development of tourism and wildlife-related revenue generation schemes, with the notable exception of sport hunting in the Central African Republic. Considerable external support to this ecoregion from multilateral and bilateral aid agencies is likely to be needed for many years to maintain or improve current levels of biodiversity.

Sahelian Acacia savanna

The Sahelian Acacia Savanna stretches across Africa from northern Senegal and Mauritania on the Atlantic coast to Sudan on the Red Sea, varying in width from several hundred to over a thousand kilometers (km). The word "sahel" means "shore" in Arabic and refers to the transition zone between the wooded savannas of the south and the true Sahara Desert. The ecoregion thus lies south of the Southern Saharan steppe and woodland Ecoregion and north of the West and East Sudanian savanna Ecoregions.

Although not particularly rich biologically, these savannas once supported a large and diverse ungulate community. The first European explorers to visit the region found vast herds of game, even larger in number than those of eastern and southern Africa. Sadly, these herds have been reduced to mere remnants due to nearly a century of unregulated over-hunting with modern firearms and vehicles, coupled with habitat loss.

Lake Chad flooded savanna

Lake Chad contains the boundaries of four African countries: Cameroon, Chad, Niger, and Nigeria. It is the largest lake in Central and West Africa and the fourth largest lake on the African continent. The lake’s waters presently cover 2,500 square kilometers (km2), only one-tenth the area they covered in the 1960’s.

This permanent shallow lake expands dramatically with seasonal floods, providing a vital refuge for birds migrating between the Palearctic and Afrotropical realms, and for resident animals. Up to one million waterbirds congregate on the lake in the Palearctic winter period. Located on the southern edge of the Sahara, Lake Chad is also critically important to the people who inhabit its shores. In recent years, these wetlands have come under increasing pressure from drought, plans for water resource projects, and intensified anthropogenic use. An estimated 20 million people rely on Lake Chad/ Hadejia-Nguru for their economic activities, a figure that is projected to rise to 35 million by the year 2020.

This ecoregion has highest biological importance for the large numbers of migrant birds that use the area, especially ducks and waders that spend the Palearctic winter period in Africa. Periodic counts of waterfowl and other species have been conducted in Chad and Hadejia-Nguru from 1955 to the present day. Seventeen species of waterfowl and 49 other wetland bird species are recorded, and abundance varies in different years with the size of the lake and wetlands conditions elsewhere in West Africa. The most abundant bird is the wader ruff (Philomachus pugnax), with more than one million seen on the lake at one time.

In July 2000, the Lake Chad Basin Commission (LCBC) met and declared all of Lake Chad a transboundary Ramsar site of international importance. A Global Environmental Facility (GEF) project has been approved for Ramsar designation, including a management plan for the lake and the basin.

The Lake Chad Basin contains some of the poorest countries in the world, and permanent infrastructure cannot be installed on the lake’s ever-fluctuating shores, compromising significant development. Because of the variable lake size, people living around its basin are chronically vulnerable to food instability. Pressures to utilize the lake’s and its tributaries’ water resources are high in this arid Sahelian region, and a number of ambitious irrigation projects have been planned. The South Chad Irrigation Project (SCIP) began in 1979 with the goal of irrigating the lands surrounding Lake Chad. The project has a gross area of 660 km2 and would divert approximately 3 percent of the annual inflow to the lake. While two of the three stages of the project have been completed, the project was put on hold during the disastrous droughts. The installations are being maintained in good condition awaiting the recovery of the lake.

Once serving as part of the floor for a much larger Lake Chad, the area now known as the Bodele Depression, located at the southern edge of the Sahara Desert in north central Africa, is slowly being transformed into a desert landscape. In the mid-1960s, Lake Chad was about the size of Lake Erie. But persistent drought conditions coupled with increased demand for freshwater for irrigation have reduced Lake Chad to about 5 percent of its former size. As the waters receded, the silts and sediments resting on the lakebed were left to dry in the scorching African sun. The small grains of the silty sand are easily swept up by the strong wind gusts that occasionally blow over the region. Once heaved aloft, the Bodele dust can be carried for hundreds or even thousands of kilometers.

The remnants of Lake Chad appear as the olive-green feature set amid the tan and light brown hues of the surrounding landscape where the countries of Chad, Niger, Nigeria, and Cameroon all share borders. The Bodele Depression was the source of some very impressive dust storms that swept over West Africa and the Cape Verde Islands in early February.

These true-color images were acquired by the Moderate Resolution Imaging Spectroradiometer (MODIS) on February 7, and February 11, 2004. Numerous fires are shown as red dots in the February 7 images.

Credit Jacques Descloitres, MODIS Rapid Response Team, NASA/GSFC

 

East Saharan montane xeric woodlands

This ecoregion is located in the Sahelian regional transition zone where high mountains rise from the low-lying semi-desert habitats. The height of these mountains creates an environment unlike that of the surrounding areas; here water is not scarce and sand does not dominate the soil structure. This isolated rugged habitat supports endemic plant and small animal species, and provides critical habitat for populations of some larger antelopes, such as the threatened addax (Addax nasomaculatus), dama gazelle (Gazella dama), dorcas gazelle (Gazella dorcas), and red-fronted gazelle (Gazella rufifrons).

The largest portion of the East Saharan Montane Xeric Woodland ecoregion is located in Chad, where it encompasses the Massif Ennedi and Massif du Kapka at over 1,400 meters (m) elevation. A smaller outlier of this ecoregion is located in Sudan, the Jebel Marra, which reaches heights over 3,000 m. This ecoregion, comprised of two isolated areas, supports dry woodland vegetation surrounded by Sahel Acacia wooded grassland and deciduous bushland. Happold found that the high jebels, which support areas of moisture-dependent habitat instead of desert and semi-desert, are more likely to have a higher biodiversity value.

 

Human activities are not believed to be currently threatening the habitats of this ecoregion, although recent reports are not readily available. Most of the agriculture once practiced in the area has been abandoned, resulting in regeneration of the landscape into more natural habitat (although not the original Olea laperrinei scrub forest type). This cannot be said of the fauna, as the larger animal species have been either removed or reduced to very small populations by hunting or competition with livestock and drought. One World Conservation Union (IUCN) category I-IV protected area the Fada Archei forest reserve in Chad also lies in part of this ecoregion.

South Saharan steppe and woodlands

This ecoregion covers a narrow band on the southern edge of the Sahara Desert, stretching from central Mauritania to the Red Sea. Annual grazing after rainfall is a key feature, in former times attracting large herds of arid-adapted migratory ungulates such as gazelles, addax, and scimitar-horned oryx. Much of the ecoregion is now overgrazed by herds of domestic livestock, and habitat degradation is widespread. Motorized hunters have decimated the wild ungulate herds, and the ecoregion's few protected areas have suffered from civil and international wars. Continued and increased external support is required to protect the ecoregion and provide alternate livelihoods and supplemental incomes for local people.

The Aïr and Ténéré National Nature Reserve in Niger and the Ouadi Rimé-Ouadi Achim Faunal Reserve in Chad are the two most important protected areas in the Sahelian subdesert zone of Africa. They probably contain the last viable populations of many of the larger ungulates of this ecoregion. However, both reserves have been plagued by political insecurity and civil unrest, and the current situation of their wildlife is far from certain. There are no protected areas in this ecoregion in Mauritania, Mali or Sudan, leaving huge expanses of habitat unprotected.

Sahara desert

The Sahara Desert is the largest hot desert in the world and occupies approximately ten percent of the African continent. The ecoregion includes the hyper-arid central portion of the Sahara where rainfall is minimal and sporadic. Although species richness and endemism are low, some highly adapted species do survive with notable adaptations. Only a few thousand years ago the Sahara was significantly wetter, and a significant large mammal fauna resided in this area. Climatic desiccation over the past 5000 years, and intense human hunting over the past 100 years, has obliterated most of these fauna. Now, in vast portions of the Sahara, merely rock, sand and sparse vegetation are found. The remnant large mammal fauna is highly threatened by ongoing over-hunting. An alternative name of the Sahara is the Great Desert.

The Sahara is a vast area of largely undisturbed habitat, principally sand and rock, but with small areas of permanent vegetation. The most degradation is found where water (oases, etc) is present. Here, habitats may be heavily altered by human activities. Previously existing tree cover has often been removed for fuel and fodder by nomadic pastoralists and traders.

Tibesti-Jebel Uweinat montane xeric woodlands

The Tibesti-Jebel Uweinat Montane Xeric Woodland ecoregion is an island of higher biodiversity rising from the dry, harsh Sahara Desert in North Africa.

Many parts of this ecoregion are yet to be fully explored due to civil unrest between Chad and Libya, and the remote location of the area.

The known flora and fauna includes endemic species and highly endangered antelopes, such as the addax and the scimitar-horned oryx, the latter of which is now believed extinct in the wild.

This ecoregion is made up of two isolated montane areas in the central part of the Sahara Desert. Lying halfway between Lake Chad and the Gulf of Syrte, the larger Tibesti Mountains area is found in the northern portion of Chad, and extends marginally into southern Libya. The Tibesti Mountains consist of seven inactive volcanoes, with the highest peak reaching 3,415 meters (m). The second, smaller area is the Jebel Uweinat, located further to the east along the intersection of eastern Libya, southwestern Egypt, and northwestern Sudan.

The steep, rough terrain of this ecoregion, and its location deep within the Sahara Desert make it relatively intact. Almost all species, both plant and animal, can seek refuge in remote parts of the ecoregion. Currently there are almost no people living in the area, allowing vegetation to regrow from previous degradation caused by grazing. Nomadic people and soldiers still use resources, however, and practice unregulated hunting. Climatic desiccation over thousands of years has affected the vegetation of the area, as with other parts of the Sahara.

Although habitats are largely unthreatened, an established protected area may be needed in the long run to conserve the species and habitats in this ecoregion. Hunting continues to be a major threat to large mammals. Since its war with Libya ended in 1987, Chad has been fairly stable politically, with only occasional security problems in the North. Fighting between armies along the border of Libya and Chad occurs mainly in the Tibesti Mountains, with one group even referred to as the Tibesti rebels. Reports noting the heavy use of landmines in the area have led to the assumption that some species loss is occurring. This political and economic instability limits the resources available for protection of the habitats and biodiversity located in this ecoregion. Even with the end of the war, time will have to pass before the region is stable enough for surveys and conservation work to be carried out.

The most recent study of the fauna of the Jebel Uweinat is that of Leonard, who studied the effects of grazing by Dorcas gazelle (Gazella dorca) and Barbary sheep (Ammotragus lervia) on the vegetation of the area. Dorcas gazelles mainly graze on the lower parts of the sandstone habitats, and were not found to have an impact on plant distribution. However, moufflon overgraze the higher parts of the massif where the flora is poor, leading to the decline of high altitude plant species and an increase in inedible species.

Context

Ecoregions are areas that:

[1] share a large majority of their species and ecological dynamics;
[2] share similar environmental conditions; and,
[3] interact ecologically in ways that are critical for their long-term persistence.

Scientists at the World Wildlife Fund (WWF), have established a classification system that divides the world in 867 terrestrial ecoregions, 426 freshwater ecoregions and 229 marine ecoregions that reflect the distribution of a broad range of fauna and flora across the entire planet.

Ecoregions of the Central African Republic

August 7, 2012 - 2:00pm

The Central African Republic has five ecoregions that occur entirely or partly within its borders:

  1. Northwestern Congolian lowland forests (just in the southwest corner)
  2. Northeastern Congolian lowland forests (in the central southern part of CAR)
  3. Northern Congolian forest-savanna mosaic
  4. East Sudanian savanna
  5. Sahelian Acacia savanna (just in the northern most part of the country)

Ecoregions of the Central African Republic. Source: World Wildlife Fund

Northwestern Congolian lowland forests

The Northwestern Congolian Lowland Forests ecoregion stretches across four countries - Cameroon, Gabon, Republic of Congo, and the Central African Republic (CAR). It is bordered to the north and south by forest-savanna mosaics and to the east by swamp forest, while the western limit grades gradually into the lowland rain forests of the Atlantic Equatorial coastal forest ecoregion.

The Northwest Congolian Lowland Forest ecoregion contains vast tracts of lowland forest, supporting core populations of the western lowland gorilla (Gorilla gorilla gorilla) and large numbers of forest elephant. Species richness and endemism are both high. Logging concessions and associated bushmeat hunting and agricultural expansion are the main threats to the habitats and species. There are some established protected areas, and the gazettement of new protected areas offers good potential for biodiversity conservation in the region.

The Dzanga-Sangha forest in CAR is protected within the Dzanga-Ndoki National Park and the adjacent Dzanga-Sangha Faunal Reserve, totaling 4,347 km2, which is about eight percent of CAR's total closed forest estate. While the forest around Ngotto in CAR currently has no official protected area status, the Forêt de Ngotto (730 km2) is in the final stages of gazettement. One of the largest areas under protection is the Sangha Trinational protected area (10,650 km2), which combines the Nouabalé-Ndoki National Park (over 4,000 km2) in northern Republic of Congo, Dzanga-Sangha complex in the Central African Republic (CAR), and the Lobéké National Park in Cameroon.

Northeastern Congolian lowland forests

The Northeastern Congolian Lowland Forest is located in the northeastern portion of the Democratic Republic of Congo (DRC) and extends into the Southeastern portion of the Central African Republic (CAR).

The Northeastern Congolian Lowland Forests contains endemic species and large areas of forest wilderness with intact animal and plant assemblages. Endemic species include the okapi (Okapia johnstoni), aquatic genet (Osbornictis piscivora), and the Congo peacock (Afropavo congensis). The forests also provide critical habitat for endangered species such as eastern lowland gorilla (Gorilla gorilla graueri). There are some protected areas, but the recent military conflicts in Rwanda, Burundi, and the Democratic Republic of Congo have made these difficult to manage. Threats come from mining, logging, hunting, and agricultural clearance of forest, often by refugees.

Northern Congolian forest-savanna mosaic

The Northern Congolian Forest Savanna Mosaic ecoregion forms the northern border of the Congo watershed, it begins east of the Cameroon highlands and extends east through the Central African Republic, northeastern Democratic Republic of Congo and into southwestern Sudan and a sliver of north-western Uganda. It includes the northernmost savanna woodlands in Africa. Unlike the Zambezian forest-savanna mosaics south and west of the Congo Basin, this narrow transition zone marks an abrupt habitat discontinuity between the extensive Congolian rain forests and Sudanian/Sahelian grasslands. With their characteristically diverse habitat complexes, forest savanna mosaics support a high proportion of ecotonal habitats, which have high species richness and are possible locii of tropical differentiation and speciation.

Increasing human population, poverty, the ongoing civil wars in Sudan and the Democratic Republic of Congo, strife between government and rebel groups in the Central African Republic and armed incursions by well-armed poaching gangs from the Sudan, mean that the northern forest-savanna mosaic faces increased threats. Hunting of animals for food, including from within protected areas, occurs in all areas, as does deforestation.

Political instability has propelled floods of transnational refugees, as well as provided incentive for widespread poaching, exacerbating negative human impact on the natural systems. Warring rebel factions poach valuable game and timber to buy munitions; mass migrations of refugees further tax fuelwood, wildlife in the form of bush meat resources, water, and soils. Ongoing economic, political and social instability have drained the already limited conservation budgets, and parks and protected areas are particularly susceptible to poaching.

The distribution of large mammals has been drastically reduced in recent times, providing evidence of the impact of habitat conversion and overhunting. Hunting camps are found far into the bush, with ivory and other valuable animal products targeted to pay for weapons as well as food. Gallery forests are logged for timber, even though high transportation costs marginalize the profitability of commercial logging ventures. Cutting wood for fuel and charcoal production threatens woodlands and forests where populations become too dense. Refugee camps produce intense local pressure on the environment, and severely degrade their local natural resources.

Climate change is also implicated in the increase of grassland in proportion to forest. Across much of the ecoregion, average rainfall levels have dropped precipitously since the 1970s. Careful monitoring of the dynamics of the forest/grassland ecotones, and the relative advance and retreat of the adjoining habitats, may offer insight into the nature and rate of climate change. Regions closer to the forest zone will continue to see increased human population in response to desiccation.

East Sudanian savanna

This ecoregion lies south of the Sahel in central and eastern Africa, and is divided into a western block and an eastern block by the Sudd swamps in the Saharan Flooded Grasslands ecoregion. The western block stretches from the Nigeria/Cameroon border through Chad and the Central African Republic to western Sudan. The eastern block is found in eastern Sudan, Eritrea, and the low-lying parts of western Ethiopia, and also extends south through southern Sudan, into northwestern Uganda, and marginally into the Democratic Republic of Congo around Lake Albert.

The East Sudanian Savanna is a hot, dry, wooded savanna composed mainly of Combretum and Terminalia shrub and tree species and tall elephant grass.

Notable threatened mammal species include large herds of elephant (Loxodonta africana, EN) in Chad and Central African Republic, wild dog (Lycaon pictus, EN), cheetah (Acinonyx jubatus, VU), leopard (Panthera pardus, EN) and lion (Panthera leo, VU). Black rhinoceros (Diceros bicornis, CR) and northern white rhinoceros (Ceratotherium simum cottoni, CR) have been extirpated from the ecoregion, although occasional unconfirmed reports of the former (from southern Chad, for example) continue to be received. The eastern giant eland (Taurotragus derbianus gigas) still survives in good numbers in the Central African Republic, especially in the western regions of the country, out of reach from Sudanese poachers. Giant eland are less susceptible to poachers than other more sedentary and less wary antelope species, but have been almost completely eliminated from Sudan. The roan antelope’s (Hippotragus equinus) cautious behavior has also allowed it to withstand poaching pressure to some degree and it is widespread throughout the Central African Republic, in low to moderate densities. However, uncontrolled poaching in Chad and Sudan has resulted in decreasing roan antelope populations in the rest of this ecoregion.

The habitat has been adversely affected by agricultural activities, fire, clearance for wood and charcoal, but large blocks of relatively intact habitat remain even outside protected areas. Populations of some of the larger mammal species have been reduced by hunting, but good numbers of others remain. Although numerous protected areas exist, most are under-resourced "paper parks" with little active enforcement on the ground, and some have suffered from decades of political instability and civil unrest. The protected areas include the Manovo-Gounda-St Floris National Park.

The poor infrastructure and inaccessibility of the region have resulted in little development of tourism and wildlife-related revenue generation schemes, with the notable exception of sport hunting in the Central African Republic. Considerable external support to this ecoregion from multilateral and bilateral aid agencies is likely to be needed for many years to maintain or improve current levels of biodiversity.

Sahelian Acacia savanna

The Sahelian Acacia Savanna stretches across Africa from northern Senegal and Mauritania on the Atlantic coast to Sudan on the Red Sea, varying in width from several hundred to over a thousand kilometers. It covers a small area of the northern most part of the Central African Republic.

Although not particularly rich biologically, these savannas once supported a large and diverse ungulate community. The first European explorers to visit the region found vast herds of game, even larger in number than those of eastern and southern Africa. Sadly, these herds have been reduced to mere remnants due to nearly a century of unregulated over-hunting with modern firearms and vehicles, coupled with habitat loss.

Context

Ecoregions are areas that:

[1] share a large majority of their species and ecological dynamics;
[2] share similar environmental conditions; and,
[3] interact ecologically in ways that are critical for their long-term persistence.

Scientists at the World Wildlife Fund (WWF), have established a classification system that divides the world in 867 terrestrial ecoregions, 426 freshwater ecoregions and 229 marine ecoregions that reflect the distribution of a broad range of fauna and flora across the entire planet.

 

Ecoregions of the Cayman Islands

August 7, 2012 - 2:00pm

The Cayman Islands  has two main ecoregions that occur entirely or partly within its borders:

1. Bahamoan-Antillean mangroves
2. Cuban dry forests which have previously been classified at Cayman Islands dry forests and Cayman Islands xeric scrub

The Cayman Islands (Grand Cayman, Little Cayman and Cayman Brac) are emergent limestone bluffs situated along a submarine ridge that runs westward from the Sierra Maestra range in southern Cuba. Grand Cayman is the largest of the group at 35 kilometers (km) long and up to 14 km wide, however, there is a large lagoon in the northern section that gives the island an irregular shape, as if a giant bite has been taken out of the northwestern end. Cayman Brac is the tallest island in the group, rising to a height of 43 meters (m) on the eastern end where sheer cliffs drop into the sea. Little Cayman is the smallest of the three islands, at only 14 km long and a maximum height of merely 12 m above sea level. Grand Cayman lies approximately 700 km south of Miami, and 200 km from both Cuba and Jamaica. The lesser islands are located about 130 km northwest of Grand Cayman, and lie 7 km apart. All three islands were uplifted from the ocean floor approximately 10 million years ago and have apparently never been connected to adjacent land masses. The Cayman group is subject to strong trade winds and has a humid tropical climate with a distinct wet season from May-November.

Cayman Islands dry forests

This ecoregion is distributed among the Cayman Islands, specifically areas on Grand Cayman Island, Little Cayman Island, and all of Cayman Brac Island. The three Cayman Islands are located at the western end of the Greater Antilles in the Caribbean. Their combined land area is 259 kilometers squared (km2). Most of the population of the Caymans lives on Grand Cayman where development typical to the Caribbean has rapidly altered the island’s environment. All three Cayman Islands are flat limestone with low elevation. The human populations of the three islands differ considerably with fewer than 100 on Little Cayman and less than 2,000 on Cayman Brac. This is reflected in the varying degrees to which the islands' environments have been changed. Little Cayman is the least disturbed of the group, with almost all of the interior untouched as of 1980. In contrast, the rapid development of Grand Cayman has resulted in degradation and alteration of most of the natural habitats. Clearing of natural woodland and thicket for roads, housing, tourism and agriculture continue to be the most significant pressures on this ecoregion.

The dry woodlands of Grand Cayman and Cayman Brac have suffered a long history of disturbance and timber extraction. The tropical hardwoods of this ecoregion regenerate and grow very slowly. Consequently, the effects of logging early in this century are clearly visible. In central and eastern Grand Cayman and on Cayman Brac, the woodlands form a complex mosaic of secondary growth at various stages. Primary vegetation is restricted to the most inaccessible areas. Little Cayman is still dominated by primary vegetation. The low elevation dry woodlands on all three islands of the Caymans are of regional importance for biodiversity conservation.

The National Trust, a statutory, non-governmental organization, overseas important natural areas such as the Salina Reserve and the Brac Parrot Reserve. The Trust owns more than 310 hectares of natural woodland and bluff habitat on Grand Cayman and has initiated a captive breeding program for the blue Grand Cayman iguana, which is listed as endangered by the U.S. Fish and Wildlife Service. The Trust is also conducting research programs assessing the status of the threatened rock iguana and the native parrots. Despite these initiatives, there is a continued need for increased species management, predator control, and habitat preservation.

 In 1989 the government gave 257 ha of land (Salina Reserve) to the National Trust. In December 1991 ownership of a 40 hectares woodland site on Cayman Brac, important as a nesting area for the Cayman Brac Parrot, was transferred to the National Trust by The Nature Conservancy (USA) and is now titled Brac Parrot Reserve. See: Protected areas of Cayman Islands

Cayman Islands xeric scrub

The Cayman Islands xeric scrub ecoregion is a low elevation very disturbed ecosystem in the Caribbean basin. The Cayman Islands are a small group of low-lying Caribbean islands that serve as an important stop-over and wintering site for migratory land birds. A humid tropical climate provides for twenty-six species of herpetofauna, seventy-five percent of these are endemic to this ecoregion. Little of the original habitat remains. Introduced animals, such as domestic dogs and cats, and rats, pose the greatest threat to the native wildlife. The extinction of several endemic mammals are attributed to these invasive species.

Evergreen thicket dominates the eastern sections of Grand Cayman, and is found on the northern slope of Little Cayman and on higher ground on Cayman Brac. The thicket has a discontinuous, two-storeyed canopy with occasional emergents. Dominant species include red birch (Bursera simaruba), Swietenia mahagoni, Picrodendron baccatum, Sideroxylon salicifolium, Calyptranthes pallens, and Chionanthus caymanensis. Palms (Coccothrinax proctorii and Thrinax radiata) are common and climbing cacti (Selenicereus) are well represented.

The two major threats to native species in the Caymans are habitat loss and introduced species. Very little native woodland remains in the Cayman Islands, as most of the large trees have been felled for timber and for fuel. The few remaining stands of trees need to be protected from future logging. In addition to the loss of native woodland, native evergreen thickets on Grand Cayman are now being replaced by logwood (Haematoxylum campechianum). This deliberately introduced species spreads by stolons, and will probably continue to invade native thickets and displace native plants.

Recent declines in the populations of iguanas and other reptiles throughout the Cayman Islands have been linked to the increased number of domestic cats and dogs on the islands, and introduced rats (Rattus rattus and Rattus norvegicus) have been implicated in the extinction of at least 2 of the 5 native non-volant land mammals, particularly the two endemic Nesophontes species. Introduced mosquitoes do not pose any obvious threat to native species in the Caymans, nor do they pose a significant health threat, but it is worth noting their success in the islands. Mosquitoes were accidentally introduced sometime soon after European settlement of the islands, and their populations subsequently exploded. In the 1970’s, mosquito density in the Cayman Islands was more than twice the maximum recorded anywhere in the United States; in a standard measure of mosquito density, one researcher recorded a total of 600 bites per minute on one arm. Mosquito populations have been greatly reduced in recent years through an intensive control program and regular aerial spraying.

Context

Scientists at the World Wildlife Fund (WWF), have established a classification system that divides the world in 867 terrestrial ecoregions, 426 freshwater ecoregions and 229 marine ecoregions that reflect the distribution of a broad range of fauna and flora across the entire planet.

Ecoregions are areas that:

[1] share a large majority of their species and ecological dynamics;
[2] share similar environmental conditions; and,
[3] interact ecologically in ways that are critical for their long-term persistence.

Bioenergy: Chances and Limits

August 4, 2012 - 1:40pm

This report from the German National Academy of Sciences Leopoldina has come to the conclusion that in quantitative terms, bioenergy plays a minor role in the transition to renewable, sustainable energy sources in Germany at the present time and probably into the future.

Bioenergy – Chances and Limits

The Leopoldina’s statement “Bioenergy – Chances and Limits” [Bioenergie: Möglichkeiten und Grenzen] provides a comprehensive analysis of the use of bioenergy.  It was compiled by a working group of more than 20 expert scientists established in 2010 and outlines under which conditions the utilization of bioenergy is appropriate.

In recent years Germany has seen a steady rise in the number of energy crops being cultivated for the production of biofuels and biogas. Because bioenergy is so versatile and easy to store, the German Federal Government wants to ensure that it continues to play a major role in the future.

Over the past one-and-a-half years, a group of experts from various disciplines have been helping the Leopoldina investigate how Germany can best harness biomass in ways that make sense from the point of view of energy and the climate. The statement on the opportunities and limits of bioenergy analyses the availability and feasibility of using biomass in Germany, provides an overview of energy conversion technologies and introduces promising approaches to producing hydrogen from renewable resources.

The recommendations contained in this statement are intended to provide parliaments, ministries, associations and companies with well-founded and unbiased support in making the important decisions that will lay the foundations for a climate-friendly, secure and sustainable use of bioenergy.

The general conclusions and recommendations have been published and are available at:

 

Sea Level Rise and Coastal Flooding Impacts Viewer

August 4, 2012 - 1:40pm
Sea Level Rise and Coastal Flooding Impacts Viewer

Being able to visualize potential impacts from sea level rise is a powerful teaching and planning tool, and the Sea Level Rise Viewer brings this capability to coastal communities. A slider bar is used to show how various levels of sea level rise will impact coastal communities. Completed areas include Mississippi, Alabama, Texas, Florida, and Georgia, with additional coastal counties to be added in the near future. Visuals and the accompanying data and information cover sea level rise inundation, uncertainty, flood frequency, marsh impacts, and socioeconomics.

Features of the Sea Level Rise Viewer include:

  • Displaying potential future sea levels
  • Providing simulations of sea level rise at local landmarks
  • Communicating the spatial uncertainty of mapped sea levels
  • Modeling potential marsh migration due to sea level rise
  • Overlaying social and economic data onto potential sea level rise
  • Examining how tidal flooding will become more frequent with sea level rise
Status of the Sea Level Rise and Coastal Flooding Impacts Viewer Tool

 

Derecho

August 4, 2012 - 1:40pm

Two types of derecho may be distinguished based largely on the organization and behavior of the associated derecho-producing convective system. The type of derecho most often encountered during the spring and fall is a serial derecho. The second type is a progressive derecho, associated with a relatively short line of thunderstorms.

Derecho

Derechos are widespread, long-lived windstorms associated with a band of rapidly moving showers or thunderstorms. Coined by Dr. Gustavus Hinrichs in 1888, "derechos", a Spanish word which means "direct" or "straight ahead".

Although a derecho's strength can produce destruction similar to tornadoes, the damage pattern produced by these events will occur along relatively straight lines. Thus the term, straight-line wind damage.

Derechos are produced by a family of downbursts clusters. Downburst clusters have overall lengths of 50 to 60 miles (80 to 100 kilometers).

A downburst cluster itself is made up of several downbursts. A downburst is an area of strong, often damaging wind produced by a convective downdraft with the overall size of the downburst varying from 4 to 6 miles (8 to 10 kilometers).

Within the downbursts are microbursts; smaller pockets of more intense wind.

While not shown in the illustration at right, within the microbursts are even smaller pockets of extreme wind called burst swaths. Burst swaths can range from 50 to 150 yards (45 to 140 meters) long. The damage pattern from burst swaths can often resemble a path of a tornado.

Due to this nature of the derecho, damage produced by these wind storms is highly variable along its path. Damage surveys following derecho events have shown that within large areas of overall damage are much smaller pockets of intense damage.

It is not uncommon for one house to be nearly destroyed while adjacent houses have relatively minor damage.

Derechos are produced by long-lived thunderstorm complexes that produce bow echoes.

Editor's Note 

 

Hand, Foot, and Mouth Disease

August 4, 2012 - 1:40pm

Hand, foot, and mouth disease is often confused with foot-and-mouth disease (also called hoof-and-mouth disease), a disease of cattle, sheep, and swine. The two diseases are caused, however, by different viruses and are not related.

Hand, Foot, and Mouth Disease (HFMD)

Español: Información general sobre la enfermedad de manos, pies y boca

Overview

Hand, foot, and mouth disease is a common viral illness that usually affects infants and children younger than 5 years old. However, it can sometimes occur in adults. Symptoms of hand, foot, and mouth disease include fever, blister-like sores in the mouth (herpangina), and a skin rash.

Hand, foot, and mouth disease is caused by viruses that belong to the Enterovirus genus (group). This group of viruses includes polioviruses, coxsackieviruses, echoviruses, and enteroviruses.

  • Coxsackievirus A16 is the most common cause of hand, foot, and mouth disease in the United States, but other coxsackieviruses have been associated with the illness.
  • Enterovirus 71 has also been associated with hand, foot, and mouth disease and outbreaks of this disease.

Hand, foot, and mouth disease is often confused with foot-and-mouth disease (also called hoof-and-mouth disease), a disease of cattle, sheep, and swine. However, the two diseases are caused by different viruses and are not related. Humans do not get the animal disease, and animals do not get the human disease. For information on foot-and-mouth disease, visit the U.S. Department of Agriculture.

Signs and Symptoms

Hand, foot, and mouth disease usually starts with a fever, poor appetite, a vague feeling of being unwell (malaise), and sore throat. One or 2 days after fever starts, painful sores usually develop in the mouth (herpangina). They begin as small red spots that blister and that often become ulcers. The sores are often in the back of the mouth. A skin rash develops over 1 to 2 days. The rash has flat or raised red spots, sometimes with blisters. The rash is usually on the palms of the hands and soles of the feet; it may also appear on the knees, elbows, buttocks or genital area.

Some people, especially young children, may get dehydrated if they are not able to swallow enough liquids because of painful mouth sores.

Persons infected with the viruses that cause hand, foot, and mouth disease may not get all the symptoms of the disease. They may only get the mouth sore or skin rash.

Prevention

There is no vaccine to protect against the viruses that cause hand, foot, and mouth disease.

A person can lower their risk of being infected by

  • Washing hands often with soap and water, especially after changing diapers and
    using the toilet. Visit CDC’s Clean Hands Save Lives! for more information.
  • Disinfecting dirty surfaces and soiled items, including toys. First wash the items with
    soap and water; then disinfect them with a solution of chlorine bleach
    (made by mixing 1 tablespoon of bleach and 4 cups of water).
  • Avoiding close contact such as kissing, hugging, or sharing eating utensils or cups with people with hand, foot, and mouth disease.

If a person has mouth sores, it might be painful to swallow. However, drinking liquids is important to stay hydrated. If a person cannot swallow enough liquids, these may need to be given through an IV in their vein.

Treatment

There is no specific treatment for hand, foot and mouth disease. However, some things can be done to relieve symptoms, such as

  • Taking over-the-counter medications to relieve pain and fever (Caution: Aspirin should not be given to children.)
  • Using mouthwashes or sprays that numb mouth pain

Persons who are concerned about their symptoms should contact their health care provider.

Whooping Cough

August 2, 2012 - 1:18pm

Pertussis leaves its victims literally gasping for air—young children and babies are affected the hardest. At first, it might seem like a common cold—runny nose, fever, and cough.

Whooping Cough (Pertussis)

Español: Causas y transmisión

Causes

Pertussis, a respiratory illness commonly known as whooping cough, is a very contagious disease caused by a type of bacteria called Bordetella pertussis. These bacteria attach to the cilia (tiny, hair-like extensions) that line part of the upper respiratory system. The bacteria release toxins, which damage the cilia and cause inflammation (swelling).

Transmission

Pertussis is a very contagious disease only found in humans and is spread from person to person. People with pertussis usually spread the disease by coughing or sneezing while in close contact with others, who then breathe in the pertussis bacteria. Many infants who get pertussis are infected by older siblings, parents or caregivers who might not even know they have the disease (Bisgard, 2004 & Wendelboe, 2007). Symptoms of pertussis usually develop within 7–10 days after being exposed, but sometimes not for as long as 6 weeks.

Pertussis vaccines are very effective in protecting you from disease but no vaccine is 100% effective. If pertussis is circulating in the community, there is a chance that a fully vaccinated person, of any age, can catch this very contagious disease. If you have been vaccinated, the infection is usually less severe. If you or your child develops a cold that includes a severe cough or a cough that lasts for a long time, it may be pertussis. The best way to know is to contact your doctor.

Pertussis Epidemic — U.S., Washington State, 2012

Since mid-2011, a substantial rise in pertussis cases has been reported in the state of Washington. In response to this increase, the Washington State Secretary of Health declared a pertussis epidemic on April 3, 2012. By June 16, the reported number of cases in 2012 had reached 2,520 (37.5 cases per 100,000 residents), a nearly 1,300% increase compared with the same period in 2011 and the highest number of cases reported in any year since 1942. To assess clinical, epidemiologic, and laboratory factors associated with this increase, all pertussis cases reported during January 1–June 16, 2012, were reviewed.

References
  • Bisgard KM, Pascual FB, Ehresmann KR, et al. Infant pertussis: who was the source? Pediatr Infect Dis J. 2004;23:985-89.
  • Wendelboe AM, Njamkepo E, Bourillon A, et al. Transmission of Bordetella pertussis to young infants. Pediatr Infect Dis J. 2007;26:293-99.

Landsat at 40 Years

August 2, 2012 - 1:18pm
The Longest Continuous View of
Earth From Space Hits 40

The National Aeronautics and Space Administration (NASA) and the Interior Department have marked the 40th anniversary of the Landsat program, the world's longest-running Earth-observing satellite program. The first Landsat satellite was launched July 23, 1972, from Vandenberg Air Force Base in California.

The 40-year Landsat record provides global coverage that shows large-scale human activities such as building cities and farming. The program is a sustained effort by the United States to provide direct societal benefits across a wide range of human endeavors, including human and environmental health, energy and water management, urban planning, disaster recovery and agriculture.

Landsat images from space are not merely pictures. They contain many layers of data collected at different points along the visible and invisible light spectrum. A single Landsat scene taken from 400 miles above Earth can accurately detail the condition of hundreds of thousands of acres of grassland, agricultural crops or forests.

“Landsat has given us a critical perspective on our planet over the long term and will continue to help us understand the big picture of Earth and its changes from space,” said NASA Administrator Charles Bolden. “With this view we are better prepared to take action on the ground and be better stewards of our home.”

In cooperation with the U.S. Geological Survey (USGS), a science agency of the Interior Department, NASA launched six of the seven Landsat satellites. The resulting archive of Earth observations forms a comprehensive record of human and natural land changes.

“Over four decades, data from the Landsat series of satellites have become a vital reference worldwide for advancing our understanding of the science of the land,” said Interior Department Secretary Ken Salazar. “The 40-year Landsat archive forms an indelible and objective register of America's natural heritage and thus it has become part of this department's legacy to the American people.”

Remote-sensing satellites such as the Landsat series help scientists to observe the world beyond the power of human sight, to monitor changes and to detect critical trends in the conditions of natural resources.

“With its entirely objective, long term records for the entire surface of the globe, the Landsat archive serves as the world's free press, allowing any person, anywhere, to access vital information without charge,” said Interior's Anne Castle, assistant secretary for water and science. “Landsat has been a game changer for agricultural monitoring, climate change research and water management.”

NASA is preparing to launch the next Landsat satellite, the Landsat Data Continuity Mission (LDCM), in February 2013 from Vandeberg. LDCM will be the most technologically advanced satellite in the Landsat series. LDCM sensors take advantage of evolutionary advances in detector and sensor technologies to improve performance and increase reliability. LDCM will join Landsat 5 and Landsat 7 satellites in Earth orbit to continue the Landsat data record.

“The first 40 years of the Landsat program have delivered the most consistent and reliable record of Earth's changing landscape,” said Michael Freilich, director of NASA's Earth Science Division in the Science Mission Directorate in Washington. “We look forward to continuing this tradition of excellence with the even greater capacity and enhanced technologies of LDCM.”

For more information about the Landsat program, visit:
http://landsat.usgs.gov
http://www.nasa.gov/landsat

Source: NASA and USGS

July 23, 2012

U.S. Antarctic Program Blue Ribbon Panel Report

August 1, 2012 - 1:11pm
U.S. Antarctic Program Blue Ribbon Panel Report

In 2011, the Office of Science and Technology Policy and the National Science Foundation initiated a major review of the U.S. Antarctic Program to examine U.S. logistical capabilities likely to be needed in Antarctica and the Southern Ocean during the next two decades and to seek ways to enhance logistical efficiency to support world-class science.  The Panel conducted an independent review of the current U.S. Antarctic Program to identify and characterize a range of options for supporting and implementing the required national scientific endeavors, international collaborations, and strong U.S. presence in Antarctica.

Now, the 12-member Panel has released its report, More and Better Science in Antarctica through Increased Logistical Effectiveness. The report is a comprehensive document based on several months of research, containing numerous specific recommendations for the U.S. logistics system for improved support of scientific research in Antarctica and the Southern Ocean.

"The Antarctica Blue Ribbon Panel encourages us to take a hard look at how we support Antarctic science and to make the structural changes, however difficult in the current fiscal environment, that will allow us to do more science in the future," said NSF Director Subra Suresh. "I am grateful to the panel for committing to such a vital review, and I look forward to reviewing their recommendations for securing and improving U.S.-led research in Antarctica."

The report is the result of the second phase of a two-part independent review of the U.S. Antarctic Program, which is managed by NSF. A 2011 report issued by the National Research Council asserted that in the next few decades, enhancing science in the Antarctic region will require substantial organizational changes, broader geographical spread, increased international involvement, and a growth in the quantity, duration and networking of observations.

NSF manages and oversees funding to support the entire U.S. Antarctic Program. NSF directly supports research in astrophysics and geospace, organisms and ecosystems, earth science, glaciology, ocean and atmospheric sciences, and integrated system science. It also provides infrastructure and logistical support for all other U.S. federal agencies and other organizations conducting research on the continent, as well as partners internationally to leverage U.S. Antarctic research, infrastructure and logistics investments. NSF maintains three year-round stations on the continent, two icebreaking-research vessels and more than 50 distributed field sites, along with the transportation platforms needed to support them, including channel-clearing icebreakers, fixed and rotary wing aircraft, and traverse and other vehicles.

The Blue Ribbon Panel report notes that logistical and financial barriers must be overcome and human resource investment adjusted to continue the success of the U.S. Antarctic Program. International engagement is also paramount in continuing this important globally relevant research. Streamlined logistics processes with a dedicated funding stream to support capital improvements will ensure that more dollars will be put to use in field research to the world's benefit.

The results of this review and the panel’s recommendation are published in the report More and Better Science in Antarctica through Increased Logistical Effectiveness.  Links to the report are at the following URLs: 

Ecoregions of Cambodia

July 31, 2012 - 1:05pm

Cambodia  has seven ecoregions that occur entirely or partly within its borders:

  1. Tonle Sap freshwater swamp forests
  2. Tonle Sap-Mekong peat swamp forests
  3. Central Indochina dry forests
  4. Cardamom Mountains rain forests
  5. Indochina mangroves
  6. Southeastern Indochina dry evergreen forests
  7. Southern Annamites montane rain forests

 

Tonle Sap freshwater swamp forests

The swamp shrublands and forest of the Tonle Sap Freshwater Swamp Forests ecoregion include two forest associations that have been described for the extensive floodplain area of Tonle Sap, a short tree shrubland covering the majority of the area and a stunted swamp forest around the lake itself. Similar swamp forests are also present along floodplains of the Mekong and other major rivers in Cambodia. Although most of the ecoregion, including the lake, was declared a protected area recently, it was too little too late. The protected area is a paper park with no protection or management, and it was declared protected after most of the habitat had been cleared for agriculture. This is prime rice-growing habitat.

Tonle Sap-Mekong peat swamp forests

The Tonle Sap-Mekong Peat Swamp Forests are only a small vestige of their former range and function. They extend over areas permanently inundated with shallow freshwater, although the region as mapped includes mosaics of swamp forest and herbaceous wetland interposed with upland areas of dry forest. However, care must be given in separating permanently flooded swamp forests of southeast Asia from seasonal swamp forests that characterize extensive areas of the Tonle Sap Basin and the floodplain of major Cambodian rivers. More than 90 percent of this ecoregion has been converted to scrub or degraded forests. Intensive agriculture and the alteration of the hydrodynamics of the river systems in the region have altered the natural river fluctuations, adversely affecting the remaining native vegetation.

Central Indochina dry forests

The Central Indochina Dry Forests ecoregion covers most of central Indochina and harbors an outstanding assemblage of threatened large vertebrates that characterize the mammal fauna of the Indo-Pacific region. Just half a century ago large populations of megaherbivores such as Asian elephants, banteng, kouprey, gaur, wild water buffalo, and Eld's deer roamed and grazed in these dry woodlands. Where human densities were still low, the landscapes were dominated by large herds of wildlife reminiscent of the savannas of east Africa. Large carnivores such as tigers, Clouded Leopards, leopards, and packs of wild dogs hunted these herbivores. Unfortunately, throughout the ensuing years habitat loss and hunting for trade have exacted a devastating toll on these species. Some species have even become extinct. The two rhinoceros species, the Javan and the Sumatran are now extinct in this ecoregion, as is Schomburgk's deer. The kouprey probably is globally extinct, although intermittent reports from remote areas of northern and eastern Cambodia keep hopes alive. Among the other species, the tiger, Asian elephant, Eld's deer, banteng, and gaur are endangered.

Cardamom Mountains rain forests

The Cardamom Mountains Rain Forests ecoregion sits astride the Cardamom Mountains (locally known as Kravanh) and the Elephant Range (locally known as Dom rei) in southwestern Cambodia and extends slightly across the border into southeastern Thailand.

It is separated from the nearest other rain forest by the vast, dry Khorat Plateau in central Thailand to the north and east and by the Gulf of Thailand in the west.

The Cardamom Mountain rain forests are considered by some to be one of the most species-rich and intact natural habitats in the region, but they are also one of the least explored.

Because of the low human population of this ecoregion, the forests in Cambodia are relatively intact; however, the areas in southeastern Thailand have been greatly reduced and now exist only in a few protected areas in hilly regions. Sixteen protected areas cover about 14,500 km2 (33 percent) of the ecoregion (Table 2). Six of these protected areas—Aural, Phnom Bokor, Botum-Sakor, Roniem Daun Sam, Khao Ang Ru Nai, and Phnom Samkos—are larger than 1,000 km2. Phnom Samkos National Park exceeds 3,000 km2.

Despite this high level of formal protection, very few reserves have effective management and workforces; they are paper parks. Several are now under threat from illegal logging operations and from adjacent concessions that encroach on the unprotected protected areas. The wildlife trade has also resulted in widespread hunting throughout Cambodia and Thailand, exacting a heavy toll from endangered wildlife populations. The widespread presence of antipersonnel land mines pose severe threat to both wildlife and humans (including researchers).

Indochina mangroves

Among the most diverse and extensive mangrove ecosystems in the world, this ecoregion provides extremely important habitat for some of the world's rarest waterbirds. The largest block of Indochina Mangroves in the Mekong River delta suffered large-scale habitat loss from defoliants sprayed during the Vietnam War.

Mangrove forests occur in coastal areas of regular flooding by tidal or brackish water and develop on saline gleysols. The extent of mangroves in coastal areas of Thailand, Cambodia, and Vietnam was once high, but much of this area has been destroyed. Extensive mangrove forests once occurred in the areas of Veal Renh and Kompong Som Bays in Cambodia. The absence of more extensive mangrove stands in Cambodia is strongly related to the rocky coastline and lack of major estuaries or river deltas.

This ecoregion is highly threatened in nearly every site where it occurs. About half of the mangroves in southern Vietnam were destroyed by Agent Orange, tank movements, and bombing during the war. Since then, however, the government has launched a large-scale reforestation program. Although protected areas have been created to conserve these mangroves-seven small protected areas (average size of only 117 square kilometers (km2)) cover a mere 820 km2 (3 percent) of the ecoregion-the majority of the ecoregion is threatened by a multitude of human activities (table 1).

Southeastern Indochina dry evergreen forests

The Southeastern Indochina Dry Evergreen Forests ecoregion is globally outstanding for the large vertebrate fauna it harbors within large intact landscapes. Among the impressive large vertebrates are the Indo-Pacific region's largest herbivore, the Asian elephant (Elephas maximus), and largest carnivore, the tiger (Panthera tigris). The list includes the second known population of the critically endangered Javan rhinoceros (Rhinoceros sondaicus)-comprising a handful of animals in Vietnam's Cat Loc reserve-Eld's deer (Cervus eldi), banteng (Bos javanicus), gaur (Bos gaurus), clouded leopard (Pardofelis nebulosa), common leopard (Panthera pardus), Malayan sun bear (Ursus malayanus), and the enigmatic khting-vor (Pseudonovibos spiralis), known to science only by a few horns. But the ecoregion's conservation priority does not rest merely on its charismatic biodiversity. Importantly, it also represents a rare instance of a nonmontane ecoregion with large expanses of intact habitat that can allow viable populations of these species to survive over the long term. Unfortunately, all is not well in this haven, for plans to log Cambodia's forests, where most of the large habitat blocks lie, will result in large-scale habitat loss and fragmentation. Therefore, the ecoregion has been placed on the critical list.

About two-thirds of the original forest in this ecoregion has been cleared or seriously degraded, especially in Vietnam and Thailand, but the habitat is relatively intact in Cambodia. A few large forest blocks also remain in Thailand and Laos. The thirty-one protected areas in this ecoregion cover 22,230 kilometers2 (18 percent) of the ecoregion. Overall, the protected areas in this ecoregion are large, with an average size of almost 750 kilometers2.

Most of the forests in Vietnam have already been replaced by plantations. Shifting agriculture has further degraded some areas of this ecoregion. But the greatest threats now are from large-scale logging concessions that have been granted to multinational companies by the Cambodia government; therefore, the conservation status has been changed from relatively stable to critical.

Hunting to supply the huge wildlife trade has created empty forests throughout most of the ecoregion. From small, homemade crossbows used to kill small mammals for local consumption to bombs hidden in baited traps to kill tigers and pitfall traps for elephants, hunting has taken a very heavy toll on wildlife. The ravages of war and conflict have also had lasting effects; mines and bombs scattered across the landscape and the easy availability of automatic weapons that have replaced the crossbows have had deadly consequences.

Southern Annamites montane rain forests

in the remote montane forests of Kontuey Neak, or "the dragon's tail"-in the extreme northwest of Cambodia, where the boundaries of Cambodia, Laos, and Vietnam meet-is globally outstanding for its biodiversity. The intact forests of the ecoregion are little explored; it takes two weeks of intense walking and braving hazards such as mines and bombs that lie scattered throughout the landscape to get to some of the remote areas of the ecoregion. But the known flora and fauna attest to the region's biological diversity, which includes some of Asia's charismatic fauna. Among the larger vertebrates, the tiger (Panthera tigris), Asian elephant (Elephas maximus), douc langur (Pygathrix nemaeus), gibbon (Hylobates gabriellae), wild dog (Cuon alpinus), sun bear (Ursus malayanus), clouded leopard (Pardofelis nebulosa), gaur (Bos gaurus), banteng (Bos javanicus), and Eld's deer (Cervus eldii) are better known.

Context

Ecoregions are areas that:

[1] share a large majority of their species and ecological dynamics;
[2] share similar environmental conditions; and,
[3] interact ecologically in ways that are critical for their long-term persistence.

Scientists at the World Wildlife Fund (WWF), have established a classification system that divides the world in 867 terrestrial ecoregions, 426 freshwater ecoregions and 229 marine ecoregions that reflect the distribution of a broad range of fauna and flora across the entire planet.

 

See also:

Ecoregions of Burundi

July 31, 2012 - 1:05pm

Burundi has three ecoregions that occur in part within its borders:

  1. Albertine Rift montane forests (green)
  2. Victoria Basin forest-savanna mosaic (yellow)
  3. Central Zambezian Miombo woodlands (orange)

 

 

Albertine Rift montane forests

The Albertine Rift Mountains ecoregion is an area of exceptional faunal and moderate floral endemism. These mountains also support the Mountain gorilla (Gorilla gorilla beringei), which is one of the most charismatic flagship species in Africa, and an effective target for much of the current conservation investment in the area. The mountain chain comprising the Albertine Rift straddles the borders of five different nations, and this makes effective ecoregional conservation a challenge in the area. Although there are a number of National Parks and Forest Reserves in the area, the recent wars have made their management difficult over much of the ecoregion. Additional threats include conversion of most forest areas outside reserves into farmland, together with logging, firewood collection, and bushmeat hunting within the remaining forest areas.

The ecoregion covers a large part of western Burundi represents the largest ecoregion in the Albertine Rift. The ecoregion is dominated by montane rainforest, but in the west, marginal fringes of the Guineo-Congolian rainforest impinge on the lower slopes (down from 500-800 m), and forest/savanna mosaic habitats border it to the east in Uganda, Rwanda, and Burundi.

Throughout much of the ecoregion, especially in Burundi and Rwanda, the rural human population density is amongst the highest in Africa. This places considerable pressure on the remaining forest resources as most families live on shambas undertaking subsistence farming. In many areas the only stands of forest remaining are within Forest Reserves or National Parks, or those stands found in the most mountainous and therefore inaccessible areas

Victoria Basin forest-savanna mosaic

which covers much of Uganda and Rwanda reaches into Burundi from the north. The ecoregion is most noted for its high species diversity and endemism resulting from the mixture of habitat types and species from both western and eastern Africa. Add the scattered wetland habitat, and you get an abundance of animals representing different habitat types. These include more than 310 species of trees and shrubs, 280 species of birds, 220 species of butterflies, and 100 species of moths. The tropical moist climate here has two rainy seasons--one in April and May and another in October and November. These help replenish the waters for the many wetland areas of the ecoregion.

 

Central Zambezian Miombo woodlands

The Central Zambezian Miombo Woodland is one of the largest ecoregions in Africa, ranging from Angola up to the shores of Lake Victoria in Tanzania and is the largest ecoregion in Burundi. All the typical miombo flora are represented here, but this region has a higher degree of floral richness, with far more evergreen trees than elsewhere in the miombo biome. The harsh dry season, long droughts, and poor soils are ameliorated by the numerous wetlands spread throughout the ecoregion, covering up to 30 percent of the region’s total area. As a result, a diverse mix of animals is found here, from sitatunga (swamp-dwelling antelopes), to chimpanzees, in the world-famous Gombe Stream Reserve. The bird life is also exceptionally rich, as is the fauna of some amphibian groups. The ecoregion contains areas of near-wilderness with exceptionally low human populations and extensive protected areas. Other parts of the ecoregion, typically close to lakes and mountains, have higher population densities and the miombo is much more degraded. Bushmeat hunting, dryland agriculture, deforestation especially for charcoal production near larger towns, and mining are increasing threat in this ecoregion.

Context

Ecoregions are areas that:

[1] share a large majority of their species and ecological dynamics;
[2] share similar environmental conditions; and,
[3] interact ecologically in ways that are critical for their long-term persistence.

Scientists at the World Wildlife Fund (WWF), have established a classification system that divides the world in 867 terrestrial ecoregions, 426 freshwater ecoregions and 229 marine ecoregions that reflect the distribution of a broad range of fauna and flora across the entire planet.

Further Reading

  1. Bailey, Robert G. 2002. Ecoregion-Based Design for Sustainability. Springer-Verlag. New York, New York. 240pp., 100 illus. ISBN 0-387-95430-9
  2. Bailey, Robert G. 1998. Ecoregions: The Ecosystem Geography of the Oceans and the Continents. Springer-Verlag. New York, New York. 192pp., 107 illus., 10 tables. ISBN 0-387-98305-8
  3. Bailey, Robert G. 1996. Ecosystem Geography. Springer-Verlag. New York, New York. 216pp., 122 illus., 14 tables. ISBN 0-387-94586-5
  4. Omernik, James M., 1995. Ecoregions: A spatial framework for environmental management. In: Biological Assessment and Criteria: Tools for Water Resource Planning and Decision Making. Davis, W.S. and T.P. Simon (eds.) Lewis Publishers, Boca Raton, FL. Pp. 49-62. ISBN: 0873718941.
  5. World Wildlife Fund, Ecoregions homepage, Accessed 1 May 2009.